Description :
From Genome Similarity Track
Location :
Scaffold_1441:767- 2140
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1441-fgenesh-gene-0.0Methylcrotonoyl-CoA carboxylase subunit alpha

Sequence
1373 bases(100 bases per row)
GCTCGCGCCTCGTCCACAGCCTCGGCGGACGCCGGGCCGCGCAACTTCCGCAAGATCCTGGTCGCGAACCGCGGCGAGATCGCGCTGCGCGTGATCCGGT
CAGCGCAGAAGCTCCAGATCGAGACGGTGGCCGTGTACAGCGACGCGGACGCGGGAGCGCAGCACGTACAACAGGCGACGGAGGCGTACCGCCTAGGCCC
GGCCCCCGCCAGCGAGAGCTACCTCAACTACGCCAAGATCCTCGAGATCTGCGCCGCCTCCGGTGCCGAGGCGGTTCACCCTGGCTACGGCTTCCTGTCG
GAGAACGCGGCGTTTGCGCGCGCATGTGCCGCCGCGGGCGTCGAGTTCATCGGACCGCCGGTCAAGGCAATCGAGGCGATGGGGTCCAAGAGCGCATCCA
AGGAGATCATGATCGCCGCGGGCGTCCCAGTCACACCGGGTTATCATGGCGAAGACCAGACATTCGAGACGCTGGAGCGTGAAGCTGGTAAGATCGGCTA
CCCCGTGCTCATCAAGGCTGTTCTGGGCGGTGGCGGCAAGGGGATGCGCATTGTGGAGCGCCACGAACACCTGAAGGAGGCCATCGAGGCGTGCGTTCGC
GAGGCGCAGGCGTCATTCGGCGACGGCCGCGTGCTGATCGAAAAGTACCTCGTCAAGCCCCGCCACGTGGAGCTGCAGGTCTTCGGCGACAAGTTCGGGA
ACGTCATCCACCTGTTTGAGCGCGACTGCAGCGTGCAGCGACGGCACCAAAAAGTCCTGGAGGAAGCCCCCGCGGTGAGTGGTCCCAGTAACAGTTGCCG
CCGCTCTGCAAGTCGCTAACGTCGTGTTCCATCGTTCACTTGATTATATGCAGCCGCACATGACGGACGCGCTACGCAAAAAGATGGGGGACGCTGCAGT
CGCGGCCGCTAAAGCAGTGGGATACGTCGGCGCCGGCACGGTGGAGTTTCTGTTGGATGAGGACGAGTCGTTCTACTTCATGGAGATGAACACGCGGCTG
CAAGTCGAGCACCCGGTCACCGAGATGATCACCAAGCAGGACCTTGTGGAGCTCCAGCTGAAGGTGGCGGCAGGCCAGGAGCTGCCGCTTCGACAGTCAG
ACGTCAAGATTCATGGGCACGCCATCGAGGCGCGGATCTATGCCGAGAACCCATACAAGTACGTTGCACTGCTCTGTAGCTGCTTTTGAGTGTCGTCTAA
CGGCCACGTACCATGCACAGCGATTTCCTGCCAGGGAGCGGCAAGTTGGAGCACATCCGACTTCCTCGTGTGTCGGACACTGTGCGCGTTGATACTGGCG
TTGTCGAGGGGGACGAAGTGTCGATCTTTTACGACCCGATGATCGCTAAGCTGATTGCACACGGCGCGGATCG