Description :
From Genome Similarity Track
Location :
contig_6:766882- 776023
Transcript NameFunction/comments
g2366.t1KUF64916.1 Dynein heavy chain 7 [Phytophthora nicotianae

Sequence
9141 bases(100 bases per row)
CTTGTTGGCTGGGATCTCGAGCCACATGACGAAGTTGGTCGAGTGGCCTGTAGTTGACAACGTGCCTGTCCGCGTGAGGATCTTGTAGACCGGACAGCGA
TAAATGCCACGTTGCGGGGCCTCGCGATGAGGCTGTGGGAACAGGTGAATGACTGGCATCTTGGCGAATAACTCGCGCGGCAACGGGTCGTCCAATGCGT
TAACCTCCGGGTTCCAGCGAGCGCCCTCCAAGAACAAACCGTAAGTGTAGCAACCATCGACAGGCCGCGTAACGAGCTGCTCGACACTTTCGCGCATCAT
GATGAACTGGAAAGACAGCGAGTCGATCGGCAGTTTGTATCGCCGCGCGTGGTTCTGAATCGTGCCAGTCATGAAACCTTGCGGGAAGAAGAAGCCCGAG
ATCCAAAAGACGGCCGGAATGCCGTGCGCGATCCAGTTGGAGATAAACGCCAGACGCTCCAGCAGGTCCTTCACCCAAGCACCTAGCGGCTTGAGTGACG
GATAAGCTTTTGCTTCCCAAACGGCAGGGACCTTTTGATCATACAGCGATGCGCCCATGGCTTCCAGTTCGGCAGACATGACTACAAGACCTTTGAGACC
TTGTTGGACAAGATGCAGCGTGCTCCGCATAACAGCCAGCAGCTTGTTGAAGCGTTCCACCTCCTGTGCCAGTACCGTATTCATGGACTCGTCGTAGCAC
ACAGGGTATGCCGCCTGGACGTGCTCCAAGTCATATTGAGCTGGTAGCTGAGACGCAATGGCCTGAGCAGCATCCGCGATAATTTCTTCGCGGCTCTTGC
CTCCACCAGAACTCACTCTTGGTTGCAGAGACAACAGCAGATCGAAAGCCTCATACGTTTCAGCCTGAGCACTTGTGATGTTCGCGTTTTCGTGCATGCC
AAAGACTTCTGGTTCCGGGTTGATCGGCAGTGAATTAATGTAGTTCACGTAGCCGTCGTACGCATTGCGCGGATCACAATCCAGCGAGTAGTAGATGCCG
CTCCTTGAGAACGCGTAGTCCTGGTGTAAGATGGCCTCTTTGAAGAAGGTCATGAGGATGACATCCGACGTCCGCATATCCTTGTCGTCAGTGATTCGAC
CACCGTAGTTGATGGTGGAGGTCATCACCTGCAGCACGTCGAAGGGCACATGGTCGTAGGTGTCCAAGAACATCTCGAGCTGCGCCACACTAATGTCCAA
GTCCGTCTCATTGAACTGATACGGGATGTTCCACCCGAGAGCACCAAACCGCTTCCGCTCGCACACGATAGCATGGTAGAAACAGAGTCCAAAGAGCAGT
TTGCGGAAGACGTCGGGCTTTCGAGTAGCTCCAAGACGCGTTTCGTCCAGCTTGTAGTAAGTGTTCTTGAGATTCGCTCGCAGTCCCTTGGGTGCCTCCT
TCGTCATCTTCACGCCATCCTGCAACACCGAGGCAGGGAACGCCGGTGTCGGCATACTCGTAAGCCACAGGCGGAAATTTTCGTGTAGTTTGGTAGGGTC
GAGTTCCTCGCATATTCGCTCCAACTCGGGCATCCAACTCAGAGCCAAGTGGCAATTCTGCAGCAAAACCCACTCGCCCTTTGTCGTGGCACCTTCGATT
AGCCGCGCCGCCAAAGTGCCTTGGCCCTGACCCAGCGCAATCGATTTGAGTTTGCTCTCCATGCCTGTGCTTACAGCAAATCCATGAAGGTCCTTGGCCG
GATCGGAACCTTGGACAGCACAAAAATCAAAGGCGTCGTCGGGGTTGCGTCTTCAAACGTGTTGGCGAGGTCGAACGGCGGCGGCTCAATAAACTCCTTG
CCAAGCTTGGCACACACCAAGTTTTGAATCCCGGGCATCATCTTGTCTGGCCGTAGGACACGCAAAATACACAGTCTCTGGAATTCGTCAAGTTTGGACA
AGAATTCACCAGGCAGCGGCTGATTTTCGGGATCTGTCGAGTCAAAGATGGCTCGGAACGCTGCAACATGCGTTGCAAACTCAACTTCAAGACCTTGAAA
AGAAGTAAAGCTGGCAAGGGCACAGATTTGCTGCCACGCATACGCTTCGAGCCATCGTGCAGCTGGGTTGTCGGCCTCGACAGGTGGGTTGGATCCGATC
CCTGAGAGCAAGAAACGCCACTCGCCAGCATCCACTTCGTTGTTCCCCTGCATGATCTTGATGGTCAGCAGGAAGGAGAATAGCAGTTTGTGCTTCTCAA
AGAGAGACCGACAAATGTTCTTGTAGACGGAGTACGTGAAATACTCATTCAGGTTTGTGAGGCGAGTCTCCAGTTGGGCAGACGGTTTGGCAGCTTGAAT
GCCGCGAACGAAAATCCCCGTGAACCACGTCAGCGAGTATTGATACATGGGATCCACAAGTGCGAGGTCGGCGATGCAGAAGAACAGCAACGCTGCTCGG
AAGGCAACCGGACGGTAACCGTCACTGCGCGCATCAATTTCGCGTTCGGTTTCTTCGGCTTCACGCATCTTCGCCATTACAACGGCGGAGGTTTCTTTCG
CCGACGCTAACGTCTCGATGAGGTTTGTATCATCCAAAATGTTACCCTCAGAGTGCGACAAGAGGTACAGGATTTGGTTTTCGATCTCGTAAAGCTGCCG
TTTACCCTCTGCATTTGATAGCACCAGTTCATTCTTCTTGGCTGCGAGCTCGGGTAATTCTTTGAGCACCACCACACCCAAAAGCTGCTCCTCGAGGCCC
TTCATTGTAATCGTAAAATTCAGCAGACTCACTTTCACGCAGACTTCCGGTGCGTAGTGCGGGTTTGCTAACTTGGTAGTGAGGAAGAAGCGAAAGCTGT
CGTTGTACGGAATCACGTTCTCACCTAGTCGGATCATGTCCTGACCTCCCTGTTTGAATTTCTGCTGCAGCAGCACAGGCTCCAAAGCGGCATCAAGCTC
CTCGCCTACGTTCTCGAGTAACACCCATTTGCCGAAGCGCAGACCGTTTTCTAGTGCACGGAGGAACCCACGGTCTGACTGTTTGACCACATCCATGCCA
TTGTCACAAAGCTTCTTATCGCGTCCAAGGTTCTTGATAAAGCGGTTAGCTTGTCCCTGTGGGTCAATTAGCAAGGGCCATCTTCGAGCACGCCCCATGA
TGATGCCGTTCTGCGTCGAGACTGTATCAGTAGGCAATCCAGCGATCTGCCACGCGCGCAGTTTTACAGGATCTTGCAGGGTCCGAATCAAATCGCAGCC
TGGAGAGTGAGGCACCGCGTGCTTTACGAGAGCTTCATGCCATGAGGCCACAAGTTGCTCACGGAACTCGGCCGTAAACGCACCCAGATAACTAATCGTG
CCGGCTGATACAAGCACGTCTCCCGTGAGGTTGGCGTAGTCTAGTGTGAGCTGGGCGACCGTTTCCTTCCAGCGAGCTTCCTCACCGCCTAGACCGCCAA
TAAGTCGTTCAGCATTCTGCAGTTGAACTTGACACTGCACCACCTTTCGTCCGAGCTCCTCCTTCTTCGCCACAGCACCATTGTAGGACTGTTCCAACTC
TGCTAAACGATCGCTTACTTGCTGCAAATTCGCTTGTGCACTCTTCAAAATTGCAAGCGTCTCATCCAACTCTTTTTGCGCCTGGGCGAGGGCTTGCTTC
TTAGGCTCGACAGCCTTGGCCACGAAATGATACGTGTACATGGCGCGTGACCACATACAGATTGCAGTACAGGCCTTCGAAGACTTCTCGATTGCCTCCG
GTGTGAAGTTCGGGTCTTCCATACTAGGCGCAACTTTCGTGATAATGGCATCTGGAATGTTGTCCTTGTCGAAACCGAGCAGGTTCTCCAAGAACTTATT
CGCATTCGAGAGCACCACCTTCTGTGCAACCTCCCAGTAGTCATTGATCTTTTTGCCAGGGCGATCAGGGTCAGGCTTGCTCACAGGCTTCTGACCGAAG
AGCATGCACACCACTTCCATTGTCAACTTGACACCAGCAGGTGGCGTCTTGAGAGCTTTGACCTCATCGATATCAGACTTTTTCAACCGATTCAAACATT
CCACAGCGGATTCCAATGCTGGTATAGCAGCATCGAGGTCACGTTGCGCCGAGTCTGCGATTTCCTTGGTGGCGCTGGCTTTGATACTGGCTGCTGCCTC
CTCTTTCTCAACCGTTGCCTTTGTCACATCTGCTTCGGCACTGTCCTTCGCGATCTGGACCATCATTTGCTCCACTTCCAGCTGCGTAGCAGCAAGAACT
GGTTGAAGCTCCACAAGCTCCGTCTGCATCGTTGCAACAATTTCCTTGGTTTCTGACAGCTTGTCCACGCCGTTTTGCAGACGGCTACGCATCATATTCA
CTTCCTCTCGCTTTGCAACGAGCACCGACTTAAATGCCGATAACAACTCCAAGTAACTTGTCGGAGTCACGTAAAAGTACCTTCGTAAAGTATTGTAAAA
CTGTTTGGAAGCCTCTTCCACGCTTTGATGTACAATCTTGAACGCCTCCACAAGCGCTGGAAGCTTGTCGCCGAGTGCTAAGTTACCATCGCTTAGAATG
GCAGAGGCGACTGAGTTTAGAGCTTCAGCAGGCCATTCACTGAACCAATCGATGGTTGAGCAATTCACCAGCGACGGGAACATTCGAAGCCGGTCACGGA
ACAAGCCGCCCAGGGGGCTCATGCAGATGACCAAATGAATGTTGCGTCGCACACGGTTGATATACTGCTGGAAGATGTTGGTCTTTGTAGGAGGGAGCTG
CCTCTTTTGACAGTCCACTCTGCATGCTGTGACGATCTGATCCAGGTCTTCTGGGCCGTAGAGATTTGGCACGTTACCAGCGTTCAAGACACCGTTGAGG
TCTTCTAGCATGGTCTCATTGACCACTTGTACGTCTGAAAAGAGGAAGACAACCGGCGTATCTTTCACGCCTGCAAGTAACAAGCACTTCTTGACGTCTT
CACGCCACTCGGTGAGTCCATAGCCCTTAACAATCTCCACCTGGAAGCACTTGTACCCTGCCATGAACGTCGCGAGCTTTGTAAGACTCTGGCGACCACT
ACCACCTACACCAAGAAGTAGCGCGTTGCCCATGGGCTGTCGAATGATTCGAGAGATGCGCGAAACATGCTCGACAGCATCCATGAAGAGCACGAGCGAC
ATGGGCGACTTGCTCTCTGCGTTGTAGTCGAGTAGGTATTCATCCATAATGCTCAGCACCTTGTCCACATCAACCACTTCCTCGTAAATCTTTGGATCAG
CACCTGGCACCAAGTAGTCGCCGTAGATCAGATGCTCATTTGTCACAACCTGATCGTACTCGCGCTGGAAAAACTCGTTCGTCGATGAGCGCATGAGCTC
GCGGAACCAGTCGTGGTCCTGCAAAGACACCATTCGGTCCTCATAGACTCGCTTACACTCGTGCACCCACAGACGAATCAACGAATCCGCTTCCGTGATA
CGACGACTGTCACCCATGAGGACACCCTGGAAAACCTTCGCCAGATCACGCAGGTTGAACGTATAGTGAGACTTAGCTGGCGTGGGAAGCAACTCGCGGC
AAATCGTATTGTACACGCTGATGGAGGCTCGGACGACATTATCGGTGAGCCGCGCGACGTCACCAGGGAAGCCTGAGCCCAGAAAGTTACCAAGGATGGT
GCTGAAGATGATGGTTTTGCTGTCATCTCCAAGTTCAGCATAACCAACCACATTGAAGTGGCGTACCAGTCGAGAAGTGATTGGGTTGCGCCCACCACCA
GGAGGACCCATGGAGGCTACGAACAGAATGTCGATGATGCTACGGAAGACGAGCAGCTTGCGGTCGTACCAACCGCCTTGATCGAACCACTGACGCACCA
GCTCCAGAGGAGGTTGAGCAAAGTACTTTTCGCGCTTGGGCATGTTCAGATCATCCACGTAGATAATGTACTTCTTGCCTGCCGGTGGGCCGTAGACACC
TTTCCGTCTCTTTTCCATCTTGGCATCCAGCATGTCCTGCGTCTGGTTAGCAGACGTCTGCGCTGAGAAAGAAATCGGGATTGGAATGTAGATATCCGCC
GGCAGGGACTGCAAGTAGCGCGTGATGTTCACTGTCTTACCAGTACCAGTGCCGCCAACCATGAGGACGTGTTTGCCGGCGCTCATCAACTCTTCGAGTA
GATAGTTGTTGCGCACAGAATCAGCAGTAGGCACAACGATTTCGGCGAAAGACGAGTTTGCAGGAACCTTGTAGGACTGACAGTGCTCATCCAGGGTACC
CATTTGTGACTAGAGAGCTGATAGCAGTAGTCGTAGACCAGTCCCGTAGGCGGTAGTGGAGGGTTGCAGTTGTTCGCCACCAACTCGCTGCGCAGGAAAC
TATCAAATCGTACACGACCAGCATCGTTTGTAGAAGCACCCACAGACCAGATCAGCGCAAAGATGAACAGCGGCTCAATGTCGTCCTTGAACTGTGCGCT
CGGTGATTTAGATGCCGGTTGAGGTTCACCGGTGCCATCAGCCGCAGGCTTTTCTCGGAAAGGGTCTAGTGTACAATCCAGTATGTTCATGAGGCTCTGC
GCTAAATTGTTATCCATCGTGGGCACGAGCTCACCCAAGAAAGAGCGAACGAACGTGACTGACGAATACAAGTACACATCAAAGAGCCACATGAACACGT
GTGCGAATGGTGCCACCGATTTTGGAAGGTGTTCGACCCACGAATCGACAAGTGGACCAAGGCCAAGTGTACTTGGCTCCATGTAAACCATACCTGTCCG
ACTAACAGTAGCCGGAGAAGCCACAGATAGATCCTCCACCTCAAACATCATCGTCATTTGCTTCGACATCTGCAGCATTTCACCACTATTGAGACAAAGC
TTCTTGTTGTCGTCAAGCACAGTGTTCATGTTCTCAATCCAGATAGCATCCACAGGCCCGTCAAAGATGACCCATTTACGGTCAGGCTTTGTGTCGCTTG
CAGCCGCACGATACAGAGTGGATAAAATACCATCCTGCCACTCGTGCGTGTTGGCATCAAATTCACCGTAAAGCTGCCCCATCGTGATCGATTTGGGGTT
GAGCTGGTATTTGATAACTTTCTCAAACGCGAACCCGGATTCTCCCCGTCGTTTCAGTTCTGTAAGCGCGTCGGCGAGCACTGCGATGTTGCATGACTTG
CCACCTCCAGTAGCACCGACAACCATGAGACCGTGTCGCACGACGATTGTTTCATACAGTTGGATGCACTTGGTGAGGAAGTACGGAACAGGCTGTAAAT
TCAGGCGATGGGTCTGCAGTTTAATCACACTAATAAGCGCACCAAGATCAAGGTTCGGACGGCATTTGCCAGGGAACAAGTCGCTGATAATGCCGTTGAA
GAGCGGGATATCGTGCGCCAAGAATTTCGGTAGATTGACATCCTGTAGCGCCCGAAGCAGCAACACGTCTTCATCCATGTCGGGATCATCGCGCTTGAGA
TTGCCTGCTGCTGTGATCACCGTTTTCACAGCACGCATGCCGTAGTCGTAGTGGAACTGGGACGAGAGCTGCTCCGAACAGAGCTTGAACGTCGTCACCA
TTTTTGCGCCAAGCGCACGTGCATCCGAGAACCCGTAGGCAAAGAACATGATCTCACCAATAAGCGCGTAATCGGGGACCATCATAGCCACCGGTCGAAA
GAGCGCTGCAAGCGAGTCGGGTAGTTCACTACGCCCAGCGTAGCCAGGATTCATGGTAATGAACACACCAAACTGGTCGCTCAGCTTGATATCCGATCCT
TCAAACACGATTCGTGTATCGCCGCGACGAATGCCAAGCTGCAATGTGACCACCTGCTGTCCTACGACCGACAGCACTTCGATATCGATACGGTTAAACT
CATCGAAGCACGCCCAGGCTCCACAAGACGCCAACCCCTTGAAGAACTTGCCCATGGCGATGTAATCCAGACCATCAGAGCAGTTGAACACAACGCACTG
TTTGGCCAGTGCCTTGGCCAAATCCTTGGTAGTTTCAGTCTTTCCTGTTCCAGCCGGCCCAGCAGGTGCCCCACCTAGGATCATCTGAAGGGCACCCATC
AGTGTGAGGTAGCATTTATCCGTCAGCGGCGTGATCACCAGTCGAAACGAATTCCCCAAGTACTCGTAGCCGTACGGACGTCGTGACGTCACTGCTTGCA
CCCACAGGTTCTTGTCCGCCCAGTAGTATTTTAGCTGAGAGCTCCACAGAAAGTCTCCCTTCGACTCCACATTTTGAGCTACAAGTTTGCGAGTGACATC
TCGGGCGTGCACATCGATAACCGTCAGAGCACCACACGTGATGCGAGCCATATTATCGAGGTTACCACGCACGAGCGTGACCATGTCAGCTAGCTGACCG
AGTTGGCGAGTCATCATTTTTTGCACGCCTTCACGTCCATCGGCATCCATGGCCTCTTCCATCTCGCGCGTCCAGTGCATTTGACTGCCATTAAGCACGC
ACATCCCCGGCCACTTTTGAATCCATAGTGATCGATCAATTTGTGTGTAGTTCGCGATAGCGCGCTCCATGATATCGCGGATGGACAGCTTCATCATGTC
TTCGACCTCCATCATCCAGTGCTCCACGTTCTTGCCCTTGGGGTCTACCATGGTCGAGAACGGCACCTTTTCGCCTTCAGCTGAGATCATCGCACTGATA
TTCAGATCGTCTTCAAAGGTGACCTGAACGATACCTTCGAAGCATTTTTTCAAATGTGGCTGCACAAGCTTGACATCCTTGGACTCTGATAGGATGGACA
GCAACTCGTCGTTCGAGAGGAAGTAAAATCGAGCGAATGCTGAGCGCTTGACTTCCAAATAGTCACTTAGCCCTTTTTGCACGAGCTCCAGGAAGTGATT
CGATTCTCGGAATCTCTCCAACAACTTCGTGCTCCGGCAGAACTCGACACACTTTGGTTTGGCTTTCGCAGATGCCAGCGTTTGGCGCCAGTTCTTGTCC
ACAGACGCAAACCGCTTGCCCTCCGCAGGAAGCTGCTTGTTAATATCGGGAGACTCGAAAATGGGCTGCAAGTACAGCCAGTTACGCTGCACAGCCAGCC
ACTCTTCCAGCACCTCCGAAATAAGCTGCAGAGTTGTGTTCCACTCGACGATCTCTTCCTCAAAGGGTCCCTTAAACGATGAGAACATCATGGCTTGTGT
CATTGTCACGTGCTCATCCAGGATTGCCTGAATTTCGTCGA