Description :
From Genome Similarity Track
Location :
contig_115:76684- 78562
Transcript NameFunction/comments
g13285.t1XP_008895759.1 hypothetical protein PPTG_03743 [Phytophthora parasitica INRA-310

Sequence
1878 bases(100 bases per row)
TGATGTGACTCCAGCCCGGACACCACCTGTCTTGCTGCAAGATGTTTACGTCGATAGACTGGTGGCCTTTTCACCTGAAAAGTCGGTGTGGATGAAGGCT
AAGGTCTACAGACCTATTGGCACTGCGTACATCGTTGGAAGGGTGTGTCGTCAAGTCAAGAAAGGCAAATTTGCTTCATTGTTTCAAGTACGTTGGCTGG
ACAGCCAATTCCAGAGCGCCGTGGAGCATCTCAGTGTGGGTGCTGTCCAACTGGTCATCAAGAACTACGTTGCCCTCACGCGAATCAAGAATCCCGACTG
GCATGTGTTGACGGAGCCTGATTCTTCCGAAGCTATTGAAGTCGGTGATGCCGAGTCTGACCTCGTAGCAGCAGATGATCTCTACGAGGCTTTTGATGCA
TCGGAGCTTCTTCCAACCAGCCTGGACGAGGTTGAGGCAATTCGGAGCATGCGGTTTGAGCCGTCAGCGCACGTTGAGGCACCTTCATATTTATATGAGC
ATGCCGATGGGACTACGAAGACCTACTTGCGTCCGGAATACAAGCACCTCTTCGATCACTCTGCGAGCTCCAGTTTCTTCGCGTACCTTCCGCTGTATTT
TTGGCGCCAAGTCCTCCACGAGACGAACCGTTACGCCGCTCTAAAAGAAGTGAAAACGTCTACGCCGTTCACACTGTCGGAGCTGATGGCGTTCCTCGGG
ATTATGTTCTTCATGGCAGTCAACGAAAAAGGGGAGTACGCCAACTACTGGGGTCCCCAGCCGGAAGACCTTATTTTTGGTGGGGCTACAACTTCACTAG
ACATTGTGATGACTCTAAACCGCTTCAAGTTGCTTAGAAGATGCCTGAGCTTCAATGCAACTCCGACGACACTCGAGAAGGATGCTGCTGCACGTATCCG
GCCCCTGCTCAACCTGCTGAAATAACCGGTGGGCAATACGTCAACGTCGGTAGGGATGTCGCCCTGGATGAGGCAAGCGTAGCTTGTCGCTCTCGTCAAG
GACGCCACCTCATCGTGTACAATCCCTTAAAGCCAACAGGGAAGTACCATTTCCGACTGTACATGATCTGCTGTTCGAGCACCTGGATTTCATTGAACTA
CAGACTTCATTGCAACCAGAGCGACATCTCCGATCGCTTGCATGGTGTTATAGGCCAAGTGGAGGCACAGGATCTACGTGAGGAGCTAGAGAAAGTGTCG
AAGATTCGACAACACGTTCTGGAGGTGGCACGACCATTTTTTGGGTCCAACAGGGTTCTTAATATGGACAACTACTACACCAGTGTTCAGCTGCCCCAAG
AGCTTCGCCTAAAGGGTCTTTACGCCAGAGGAACGATACGAGCAAACAGCAAACACTTCCCCAGCCACACTATCCTCCACAAAGACGATTGCGTGCGCGG
TGATCACCGGCAGGCTGTCTCCTCTGATCATAGCATGCTTGCAGCCTCGTGGTGTGACGGAAATGTGGTGAATATGGTGTCGAATGCTGACGCGTCAACT
ACCACTACCGTAAACCATATGATAGGAAATGAGAGGCGAGCTTTCTCGGCTCCTGTTTGCGTTGCTCGATACAACAGGAATATGCAAGGGGTGGATAGAC
TCGATCAAATTCGAGGACGATTCTCTATTGCGGACGGGCACTCCTACAAGCGCTGGCATAAGAAACTTGCCTTAGCGTTTATAGATGTTGCAAGATCGAA
TGCTTACTTGACACGACGGCTGGCAAAGCCCGATTCTACTGCACGAGATCCCCATCGAGCGTTCGTCACTGAATTGGTGGCCGAGCTCATCAACGGTCAG
TGGGCTGAAGCGCCTAGCGAAGGTCGTATGCTGTACACAAGTCGTAATGCTGAAGAAGAGGAAGATGCATCAGCCCAC