Description :
From Genome Similarity Track
Location :
contig_5:7667- 9536
Transcript NameFunction/comments
g1490.t1hypothetical protein

Sequence
1869 bases(100 bases per row)
CACCGCGGTCGCCGCCGCTTTGGCTCGGCTGGCATCTCTTCTCCGCGCGCGTGCTTTCGCGCCATTTCGTACAGGGAGAAAAAAAATCAGGAAATGAGCG
GTTTGCACAGCCTTCAGAGTGGTTGGTATAGTTTAATAAAGACAAATGCTCCACATAATTGCTCCCGGCAGGTGCACGTCTATGCAAGGATACCATATGC
GATGGGAAATTTACGTTGGGGGGCCGTGGTTTTTGTGGTGTTTCATTGGATCGTTTGGACCAATCACTGAAGAGGAGTCGAATCTGCCCAATCAGGTACA
TGCCAATGCAGTACCGTGTCTTCGTAAAAGGAGGCAAAATGCCTCCTTTTACAAGGGCCCTACCGCAAAATGTAACTACAGGTGTCGTGTTGTCTGACTG
CGTACTTAGCTGGAGAGCCCATCACCACCTCAAAAGGAGGCATTTTGCCTCCTTCTACAAACCAGTATCTTAACTTTGTATAGTATAGTTAAGGTAGGTG
GCTCATGAAAGGGTTAACCCCCCTACGCCCACACGTTGTATTTGACAACATGAATCATGTTGTACGTACAACATGTTTGAATAGGGGTTGGCTCGGAAAA
CGGCTAAGTATAGTGAACTCAAATTTAATCAAATGCTGACAAAGCCGAGACTTTCCCGCAAATGCACAGGAGTAGGCATAAACCGTTCATAAACGAAACT
GGCATCGGTAGATGGCTGGTGTTCATTTGAAGAAAAATAAAAAGAACGCAAGAAAGCAGGAGACGCATGGCGAGGAATAAGGCCCGGCGAGAATCCCGAG
CTCAGCACCAGCGCGTTCTGGAACGTCTGGGTGGTCGTAGGCCCAGAGGAGCGGCAGCATCTTGTGAAGGAACATGCTGCCTATTTGGCCGGAGAGCGCG
ACACCGACGTTGACTTCAGGGACGACAACCAGGCGCCATCAGCGGCTGAAGAGCCGCGCACTGCCCCCCGCAAGACCTGGAAACCTCCGGCGAGACCTCC
GACGGGTAAGGACGTTTCTTACCTTAGGGCCCAGAAGCGTCTAGTCTCCGAGCAGCGCCGAGCTGTTGCCGCGAAGACGTCCGCTGGCTCTGGAAAGAAA
CTGGCTGTCACGAGAACTACCAAGGACGACGACAGCGAGTTTAATCCCGACGAAGTAGATGATGATGACGACGAGGAAGTGGAGGAGATGGATGTCGACA
GTGTTGAGAAGGAGACGGAATCGAGGGCGGCGAAAAGGAAGGCAAAGCCTGTGGCATCGACGACAGCGAAGAAGAAGGCAAAAAGCAGCACCAACCCTCG
AGGGAAAAGTGGTAAAGGTATGTCATGTTTGATGTTGTATGATACAGCAAGTACTTACAACTAGCTCATACTGGATGAAATGCAGGTGCAGCAAAGCCTC
GAAAGCCAAGTGCTGCCCGCGTGGCCAAGGAGAAGGAAGAGAAAAAGGCAGCAGCTAAGAGTCGGTGTGCAGCCACTGCAGCTGCCGAAGAAGCGGGTGC
TGCAGCGCACGAGGATGCGAGAACAAAACTGGACAAGAATTCTCCAGCTGCGAAGAGGCGTCAGAAGAACGTAAGTGTCGCGGTGGTGCCGAAATGTAGC
GGGGCTACACATTCGGTTCACCTCCTACCTTTGTGCAACATGCACTAAGGGATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGC
ATATGACTGGTAGAAAGTAACATCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGTCAGCCATCTAATGGCAGAACCTCTCATTAGAAATAT
CAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTTATTTGGTACCAAAGCTATCGTTCGGTT