Description :
From Genome Similarity Track
Location :
Scaffold_7:766562- 769021
Transcript NameFunction/comments
Aphas_H257_03608kinesin-associated protein, putative

Sequence
2459 bases(100 bases per row)
CGGACGACTTGGACACGTACATGGAGAAGCTGTACGAGGAGGACATGGAGTCCAAACTCGACGGCATCACGCAGATCCTCAACCTGTCTGAATATGGCGC
CAACATTGAAATGCTCGTGCAAAACGAGGCGTTGATGGTATACTATAAACTCCTTACTACACTACCTTGCAGTCCAAAGGTGGGGCAGCTGACACTGGCT
GGTTGGCTGTTCGTAGTGCCTCCTTTCTAGGGTTCTCAACGACGAGTACAAGAAGAACTACGACTTTACGCTGCACATGATGCGGATCTTTTGGTGTTAC
TCGAACTTTCTCCAGCTGCATCCGATCCTAAGCAACTACCGCATTGGCGCGATCACATTGAAAATCGTCGATTTTGAAGTCAAGCGCCACCAGTTGCGCA
TCGAAGAAGAGAAATTGCTCCAGGAATCCCTCGTCAAGGCCAGTCACGAGCACCCGGATGTCCTCGCCAAGCTCAAATCCGAGGCCAAAAAGAACAAGAA
GCGTTCGAAAAAGCAAGATCAGCTCCTGTACGTACTTACATATATATATGTAAATATTTATACACATTGTAGATTCGTGTGCCTGAGCGTGCTCTTCAAC
CTATCGGAAGACATTCACACCGAGCGCAAAATGGTTAAGAAGAAGATTGTGCACTTTTTAGCGAAAATGCTCGACCGCGTCACGCCCGACTTGGTGATTT
TAACGCTCGGGTTTTTGAAAAAACTCAGGTAACGTTATGGCTAAAACCTTCCAAATATTTCACGAATATACGATACGGCACATTATTAACCCTGTCGTCC
GTTCGTTCGTTCATCTTTGGTGGAGTAGCGTGTTTGAAGAAAACAAGGACACGATGATCGAGTTACAAGTGCCGGAAAAGGTCATTCGCTACGTGAAGTG
CAACCACGACAAAACCGCTCAAGTATGTCCTGCACCTACTTCCACGACCTGCACCTACACCTAAGTCCATGCCTATAGATTGCACTGAAACTGCTGTTCA
ACCTGTCATGGGACGCGCGGGTGCGCGATGCGATGGTGAAAAACAGTTTAGTCCCCAAGCTGGTGGAGCTGCTCAAGAAGCCACCGTTTCGAGCGCTCAC
GCTGCGCATTCTGTACCACTTGAGCATGGACGACCGGTGCAAGTCGATGTTTACGTACACGGAGGCGATCCCGATTGTGATGCAACTGGTGATTAACTTT
CCGCAAAATATGGTGGCCAAGGAACTCATGGCGTTGGGCGTCAACTTGAGCGTGAACGGGCGGAACGCGGAAATGATGGCGCAGAACAAGGGCTTGGACG
CGTTGGTGCAGCGCGTGTTGCGGACTCGCGACGTACTGCTCATGAAGGTACGCCTGCAAATGTGTATTTCAACGTTATTTAACGTTGATTAACGTTGACA
ATCAAACATGTTCTAGTGCATTCGCAACATTTCGCACTGGTCGTTTAGTTTGCAAGAAGACTTGGCGTCTGAAAAAATGTACAAGCACAAGGGACTGTGG
GCGGCGTACGTCGTGCCTCTGCTGGAGCTAGCGCAGAGCTCCGACAACCACGACCTGGTCGTGGAGATTCTCGGCACGCTGGGCAACCTCACGCCGCAGG
ACCTGCCCCCCAAGTCGTCGTGGGATAAAATCCTCGCGCAATACTACACAGTCATTCCGTTTCTCAACAAGTTGCTCGTGCCCGGCTTTTCCCAAGTACG
TACAATTGTATATATATATATATATCCACACTGAGTTCGTCTCGTTGGCATGCGTGAGGGGCAATACCGAAAATGTAATTGATACTGTAGCGCTACTTTT
TGTATTTGTTTTCATGTAAACTTCGTCGCATGCATAAGAGATTCCATGACAACGCCATGCTGTAATCTGATGCGGTGGAATACATGGGGCATGGGCCGAG
GGTGTATGAGATTGTCATTAAGGCGTTTTATTGTCTACTATTAGTAATATTTTTTAGTTATTATTCTTTATTTCTTATTTGCATATTAATGTGGATGGAT
GAGTAGGACGACATGGTGCTACAAGTGATCATGTTTGTGAGTGCGTTGATGCTCGAGCCCAAATGCGCGCCGCTCATCACGTCGTCGCGTGTCGTGCGGA
GCTTTCACACGATCTTCCAGGACAAGCAGAGCGACCACGAGATCACATTGCAACTGTTGTTTTGCTTCTACCGGATGCTGCGGCATCCAGAAACCCTCGA
CGAAGTGCTGTACGGCACCAACATGCTGCCGGACCTGCTGCTCGCGGCCGATTCGACCAACGTCGAGGTACGTCACTCTTCTTGTACATCGTCATCATCA
CGAAAGCCTCGTTACGATAATAATTTTACCGGACAGGTGCGACGCATGTGCGATTCGGTTTTGGACGTGATCTTAGACCACGACATCCATGAAGGCGAAG
TGGGCGAGTTTGGCCGACAGATCCGCCGCCGTCGGTTTGAAATCCACAACGCAGAGTAC