Description :
From Genome Similarity Track
Location :
contig_31:76656- 78742
Transcript NameFunction/comments
g7110.t1hypothetical protein
g7111.t1hypothetical protein

Sequence
2086 bases(100 bases per row)
CGTCAGCCAGCTTAGTTCTGGATGCCGGGCTTGGATTGCACAATCCAAGCAAAACACGCCACTCATCCTCGGTGATAAACTGCGGTCGATCATCCGGAAG
ACTTTTCGTAGATTCAGGTTTCCATGAGTCAAAAGTCTCGTCACGTTTGTCCGACGGCTGATTGGAATTGCGAGAACGAACAAGAAGGAAAAAGACTGAA
ATGCCAAACCGCAGCACATTGTGAGTCACCGGAGACTCGGCTGGATTCGTGTCTCGAAAAGACCGATCGGCTTCGCTCCTCGGCACAAGTCCCAGTCCAT
CCACAACACCTCTGCGCTCCGAATAACTGCAGAGGAATGTCGATGGCGACACATCATGGTACGCTAGTCCTCGATCATGCGCATACTGGAGACCACGAGC
GCAATTCGCCGCATAACGCCACAGATCCATCTCGTAGCTGGGCGAAAAGCAGGTCTCGTGGATGACGAAAGGTTTGCCAACGTGAGAGGCGCCGTAAAAC
TTGCGCAGGTGCGGGTGGTTGAGCTCTGTCCAGATCGATGCCAGTCGAACACAAACTTCCTCGCTTATTTCTCCCCGAACCTGATCACTCGCATTTCCAT
CCGTGTATTTTGCTCGAGCTTTGCTGTCCCAGGCCCCCTTGCTGTCCTCAACCTTGGCCTTGTTCACCCACGCCCACTCGTGATCGGAGGTGAAAAACCA
CTCGGGCGGCTTCCCTGACACCACGTTCGTCTTTCTCACAACCAGCTCATAGACCATCGCAAGCGTGTCCAGCTCGCCCTCCGTCAACTTGTCTCGGTAT
TTCTCGTCAGCACCAGCAAATGGTGTCAGGCCGTCATGATACTTTTTGACACAGTAGCGCAGCAACGTGACGATTTCAAGTTGCTGGTTCTTGTTGCCGA
AAGCAGCAAGTAGCTGCTCCTCGTCTTTCACAAAGGCTTCGAAAACTTTCAGTCGCTCCTGGCGTTCTTGCAGGAGTTTGCTGTGCCAAACCTCTCGCTC
CTCTTGGTCGAGAATGTTGAGCATATCCAGTGCATTGTCAATGTATTGGTGCAGCAGAGTAGTCACCCGACCCGTGTCCGCCAGCTTCAACAGCAAATTG
GCTTGGCTCTCGTACGAGTCCAGCAGCTCCTTCAAAATGCGAGTGAAGCGCACCATGATGGCCACCTCGCTTGTTTCGCCACGACATTCGTCGCGCAACT
TGCCCACAAAGTGGTCGGCCAGGCGGTCGTCGGTGATGAAGTCGCCCTCGTGCCTCGAGTGCCACCGACTGTCGTCCGGGATCTTGGAGTCCATCCAGAA
CTTGGTCATCGTCTTGCTCATGTTCGTCGGCATGGCGACTGAAGACGCCGCCGCCCGTGGATCTGCGTCTTCTCCTGCAAATCAAAAGTGAGACTGGTTG
GTAGTGGAGGCCCTCCGCTGGAGGGTCGTCCCGTAGTTATCCTTGCAACCCACACGCCAGCCTCATTCAAAAACCAGGTACCCATCGACAACATTCTGTG
GCCAGACGTCGCCAGAAAAGCCGAGCGTTTGTGTAGTTTCTTAGCCCACGAAGGATACTCCGGTTTCATACACTTGAAGGAAAACACTGACAACATCATA
CTATGAACATGACTGCAGCGGTCGAAAAGAGAACAGATCCATGAGCTCAAGTTGAGCTGTTCGACGATATGAAGGCGGCATTGATACACTTCAAAGTACT
TCAGTATGCAGCAGCGCAACTGAAATGTAAAACATCAAAGGGCAGAAAACCCTTACGAATTGATGGTAGAATGGTATGTTTTGAAGGTGAAAGTCAACAA
AGCAAACTATACATATTGATACTGAGGTATTGTCGGTCAGTCTACGCTCATTAGACCAGATTTACCAATAAAATTCCTCCACCGGACTGCCATCCGCGTC
CAAGAGGCTAATCTTCAGGAACATGTCGCTCTTGGGTGCTCCCAGCCCGCCCACTTCGTCGGACAGCACCAGCGGGTAGCTGCACAGCTCGCAGTTTCTG
TTTCCGGCGTACAGCGTCAACGGAATCACCGCTGAGCCAATAAGGTCGTCCTCGGCGGTTCGGTTTTGGTCGAAGACCTGCGCAAT