Description :
From Genome Similarity Track
Location :
Scaffold_45:76644- 84470
Sequence
7826 bases(100 bases per row)
TACTGGAGGAGGTCGTCTTTCCACCGCCGTCGGAGTTGGGTATTTTCGTCTTTCCACAGCTGGTGGCTGGTTTGACAACCAGTCGTCGTACAGTCGTTGT
TCTTTCTGCAGCAAATCTTTATCCATCGCCGACTCAAAGGCCAATATCTGCCAGTCACGGTACTTCGCCGAGCTCACGCGGACATATCCCTCATTGGCCA
GTACTCCGTGTGGTTGCCATTTTATCACATAAAAGTGAGGTGGGCACCAGACTGACGTCGGTCGTACGTTCGTAATCAGGACATGGGTTGGTCTTCCTCG
GCGATTAAAAACAACCGTTGGAATCCAACCCTTCGTCCGTCGCACCCACAAGTCATGCGTCGACTCACTGGGTTGTCGCCTGGGCAATTTGAACTCAGCA
GTCATTCGACTTTCGATCGTTAACCCGTCTGGTGGTCCGCATGGGACATTTGGTCCGACCTCGGTCTTGGTCGGCGCATTACTTGATCGGATGAGTGGGA
TCACCATCTCATGGGTAGCTTGACCGCCGAGTTGTACAGATCCAGACGGATCCCAGCTGGGATCATGAAGTCGGTGCCGAGAATCAAATCGACTCCGGCA
TGATGAGGCATTATCCATACTTCGAACTCGTATGCCACTTCCCAGCCGAGTGTCACCTTCACCACTGCTCTTGACGTTGTCACCATTCTGTCTTTACTTA
TTCCTTGTATGTCGATTCGCTTAACTCGGCTGGCCACTCTCTTGAGACGCAATTTTCTCGCGAAGTACTCACTAATCGCCGAGACATTTGCTCCGGTATC
CAATAATATCTTGGTCCTGTGGTCGTTCACTGCGCCCAATACGAGGGCTCTCATTCTAACTCGGCGATCAAACGTCTGTGCTGACCACCATCCCAGCCGT
TCCCCCGGAAGCAGCTTCATGATTCTGGTACGATGCACAGCCTGGTCTGACTGCCGAGTTACACTTGCAATCGCTCGGTTGTTATCATCTAACTCACCGA
GCTCACGTTCAATTCCGTCGATTTCACACATCCAATTGCCATCCCCGCTTCTTCCCTCAGGCCGTCCTGCTTCGCCTACAAAGGCAAACAAGAAGTTTGC
ATCAACTGCAGGTTCAGCTGACTGTGGCAGCCCGGCATATTCCAACCCAGTCAGTGTTGGCGGGCCGCCGAGTTTAAATCACTCGGCGCGGAAAGGTTTT
GCAGGTCTTCTGGCACTTGCCACTTGTCGACAGAGTTTTTTTTTACGAACGCAGCCAACTTCTCATATTGACGAAGCAGCTCGCACTGGCCGCCTTCATG
GACTTGTCTGCAGAATTTGCAGCGTCGTCGACAGTAGTGAGCCGAGTGCCCCGTTCTTCCACAAGCTGCACAAGGTCCACGCTGAGTGTTGTCGCGTGAT
CCATCTCCACGGCTCGACTGTTCTCGTTTGTTGTACGGTCGCGGCGGTCGGTTCGCTGAGTTTCCCCAACTTCGATTTGAGCCATTCTGGTCTCCCGCCG
AGTTCTCTCGGCGGTCCGGTGTATTTCCTTTATCATTGGAAACGCCGGCGTCTATGTAATCGTCGTCTTCCGCTGAGTCGTGTCCTCCGGACTGGTCCTC
ATCATCCCATTCGTCTTCGGAGTTGTACGGACTCGGCGGGCTCTGATCGATGAGTTCCTTCCCCTCGGAGTCAGCGTCAACGACAGTGACTCGGCGGTCG
CGGTTTTCTTCCTTGCGACTGCGCTTCTCATCTCGACGTCCATCTCGGCGTTCATCTTGGCGGCTCTGATCCTTCCGCTTGTCATCTCGGCCTCGTGCGA
TCACGAGTCGGTCGCGTTGCTTCTTGCGCTTCTCGCCGAGGATCCGACGATTGATTATCTGTTCCACCTTACTGATGTCTACCAACTGCAAGGGGTACAT
CAAATCCATCACATCATCATCACCACAATGCAGCAAGAAGTGTTCGACATGGTCAGCCGCGTCGGCGCCACCCTTCTCGTACTGGATCTTGGCTGTCCGA
GCATACCCGTTGAGTCAGATCAGGAAGTCGCAGATCGGTTCGTTGACTTTACGTCTCGCCGAGTAGTAACGAGTGCGGGCGGATTGGTCGAACTGTGAGC
AATAATAATCCAGGAACGCCTCGCTGAGTAGTTTCCAACGTCGCTGAGTCTTCTTCGGCAGCTGCCTGTACCAACTCTTCGCCGCACGTCCCAAGCATAG
CGAGAAAGGCTCGCACCATGCACTTTGGGGCATCCTGGTGCTCTTCATCTCGTAGATGAACGCTTGAGCTCACTGGAGCGACGCGTCAGAGCGGTAGCGC
TTTCCTTCGAGCTCGGCGATTTTGTCGAGCGAAGCGTGGGTTCGGACTTCTAGGTACTGCGTCGAGTCCTCTTCAGCCGCGTCAAAGCTCAAGTTTCGGA
TGTAGTCCTTCACGGTTTCTTCACGGTTAGCTCTCACGTCGAAGGTGTCGTCATCTTCTTCATCCTCCTCGTAAGCCTCAGCCTCATCTGCAGCGTCATA
CAATTCACGGTAACGACCAACATTCCGCTGCCCCCGACTCGGCGCTCGCTGAGTCGGGTTTAGCTTCATTGGAGTCAGCATGTGGGAGTCTTCGAAGTAC
GGAGTCCCTTGCGTAGCGCGGAACACTTCACGTCTCTTCGTCTCCGGTGTCTTCGGCAAAGGAATCTTGCTTGGGACCTCGCCGAGTGGTTTGAACTCGA
CTACTCGGCTGTACACCTTCTTCGTTCCACCAGGGGCCTTCTCCAATCCAAACCCCACTCTCAGCTTCTTCTTCCATTGCCAGAGCTCGGCTCCGCCACG
GGTCAGACTCCAGTCGGACAGGATGAGGCTGTTTGGTCGGCTGTTGCACCGATAGCCCATCGCCTTCAACAGCAACACAGTTTCTTCCACCAACTGATTG
ATGTTGGCTGCACGCACCGGCTGAGTTAACTCGGGACCCAACATCGGCCACTTCGCCTGCGCCATCGCGACAGGCGCGAACATCATCATCCATTCCGATC
TCGTTCTCATCTCCTCGCCGAGTCGAGCCAACACTTTATAGGCGCTCGGCGTATCGGCGTTCCTCGTCGCTTTCGGAATAAGGGGCGGACGGTCCCCTTC
AGCAACGCCATGCTCTTCTTTATCTTCTTCATCGTCCGCACCTTCGTCGAGCTCGGCGGATAAGTTGCGCTCGACAGGACGTGGGGCTCCCATGCGTCCC
ACCTGCAGCGTCAACTCCTCCACCTCGCCAAGTAGCTCGGCGGTAGTCTTCGTTTCTCCGAGCTCAGCGGTCTCGGCCTTCTCTTCATACTCTCCTTCAC
TTGCATCTCCGTTCTCGCTCTCCTGGTCTTGGCCATCCTCGTCGAACTGGACGGCTCGTCCCACCTCCATCGTCATGGCGATGAGTCGTTGATCCGCCGG
GTCCGACTCCGCGAGAGGCGATCCTCCAGCCGTCGCTGGGCTTCCGTCGCTCGGAGTTGCTGATCCCTTGACCATCTCCACTTTTCTTTTTCTCTTTTCT
TCCTCTTAACTTGGTTAGCTGGCACCTATAAAAACAAGCACACACTCCTGTTCCCGGGTCGCGGCACCAGTTGTGGTGTAGTAGAACACACAAATATCGT
CAGATGTGGATTCCTTACACAAACCACAACGAATCGCCGAGTTAGGTCGGCGGTTGTATGGCCTGCGCAGAGGGTGGTCCCCTCGCGGTCCGGCCCTTCC
GGGACAGACGAGTGGCTCGCTTCCACTCGGTTCCGACTAACCAAGTCAGATCACTTCCGAGGCTCCGCCGAGTTTGGTTCGGCTGAGCTCGTTCACAGCC
CTGTGCCCTCCACCAAAGGATGGACGACGGCGCGCGAGCGCTTTTACAGGTCACCGAGCGCAGAGGCTGCTCAGCTAGAAGTGTTACGGCACCCGGGCTA
TCCGACGTACCGGCCCGCTGAGTATGCGGGACTTTCTTTCGCGCGTAGCGAGACTTTGTCCTACCCGGACCGACCTAATCTCTTGGCGCTACCAGTCAAT
ACCCTACAAGCTATGCCTCTCGAGTATTGACGGCAGGCATAATCCAGCCCTATGCAGGGACTTACCGGAAAAGTGTACACGTGTCTTGGACTAGGAAAAT
TCTGCTCTGTTATCTTCTGGGAGCCCTTTCGGCTCCCCCTATTTAATCCTATGCTTTTCATACAAATATCTAGTGAAATGTAGTCATTTCGGATCTCTAC
CGACCCTTCAGCTGAGTTCCGGCGACCGTTGAGCTCAGCGGCTATCCGGATAGCATATCCGGACAGATCGCCGAGTACTTACCGTGATCCTTTGCTCCTA
AGCTCTGGGTTATCAGACCGAGCCGATTCTTGACCTAAAGTAGGTCGGCGTATGGTCGAATCTGGAAATCCCTACACCACATTAGGTCCTTCGCAAACTT
GGTCTGACGCACCGACACTTTTCCTGTAGCCATATCTTGATCGATCTCCATACCGAGGAAGTACTTGAGGCAACCCAAGTCCGTCATGTCGAAGCGTTCA
CTCAAAGCCTTCTTCGTCGACTTGAGAAGCTCGTCGTTGTTACTGGCGAGGACCAGCTCATCGACGTAGAGAGCCACGAAGATCATGTCTGGGTCATCCT
ACTTGACGTAGATGCAGTGATCGGCTTCACACTTCTTTAACGCCAGCTCCAGCATGAACTTGTCAATGGTCTGGTTCCACATTCGTGGCGACTGCTTAAG
ACCGTAGAGCGAGCGCTTGAGATGACAGACATAGTCAGGATGTTCTTCATCAGTGTAACCTTCCGGTTGCACCATGTAGATATCTTCATCAAGCAGCCCG
TTCAGGAACGCCGTCTTGACATCCATCTGGTGCACCGTCAGATTGTACTTGGCCGCCAGACTGAGCAGGATCCTGATCGACGTGAGCTTGGCGACTGGCG
CAAAGGTTTCTTCGTAGTCGATGCCGTACTTCTGCGAAAATCCCTTGGCCACGAGTCGTGCCTTGAACCGCTTGATCTCTCCCGCTTGGTTCTCCTTGAT
GCGAAACACCCAACGACAACCGATAGCCTTTCGACCTTGGGACAATGGCACCAACGACCATGTCTTGTTCTTGCGAAGAGAGTCGACTTCTGAGTCGCAC
GCCTCCTTCCACTTGGCCGCGTTGCTGGATTCCATCGCCGACTTGAACGTAGTCGGCATTTCTCCCACTGAATCCACAACGTAGGCCGCTTCGAAATCTT
CTTCTCAACTACTTGCGACCGCTGACATCTCCTCCAGCGTCTGCGGCCGACTCTGTCGCTTGCTTCGCGGGATCTCTACCGCTTCCTCCAACGACTGCGC
TCGCTCGTGTCGCTTGCTGCCGGGCTCAAATTCTTGACGCGGTGAGTGTCTCCATTCGTCTCATCCTCGAACGATGCTTCTTGATCCGCTTCTTCTTGAA
GCTCCACGATGTCATCTTCATCGTGGCTGCGTCTCCCTCCGTCGAAGACGTCTTCCATGACCTGCACATCGCGGCTCACTAGCACACGACCGCTCTTGAC
CTCTTCGAAACGATACGCTTTCTCGTGTTCCGAGTACCCCAGAAACCGACACTTCACTGCTCGAGCGTCCAACTTGGTGCGTTTCTGCTTCGGAACCGTC
ACATACGCATGGCAACCGAACACCTTCAGGTTCGCCAGCAGTGGTTTCTTACCGGTCCATACTTGGTGCGGTGACTTGTCATGGCTGATGGCACGTGTGG
GACACCGGTTATGTAGAAACGCAGCGGTCATTACCGCTTCACCCCAATACGACTTGGCCAAACCAGCATGCTCCAACATGCAGCGCGCACATTCCACCAG
CGTCCGGTTCATTCGCTCGGCGACATCGTTTAGTTGCGGCGTGTACGGAGGCGTAAACTTCTGCACGATACCACGATTCTTGCAGAACTTAGCCATCTCG
CCCGACGTGTACTCGCCACCGTTGTCACTACGAAGCGTCTTGACGACCTTGCCGGTCTGTGTTTCAGCAAACTTGTCGGCCACTTCTGAATTGTTCCGGA
GCAAATACACCACACAGAAGTGCGAGTACTCGTTGATGAACGTGACAAAGTAGCGTTTGCCACTGAATGTCGACGTCTGCATGGGACCACACACATCACC
GTGAATGATTTTCAGCAGTTTCTTGGCGTGGCTGGGTGACTTGGACATGAAGCTCACTCGCGTTTGCCTGCCGAGTGCACATCCGTCGCACAGCTCCCAC
TGTTTCACCGACGTCATGTTGATGCCTGCACCGTAGTCCTTTTTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAAGTCGAAGATGCCAGAGGT
ACGATGTGGTGTATCCTTCGAGCTTGCCGCATTGGCCTCGTCGGGCACAACTGGTGTCATGCACAGCTTGAACAGCCCTTTGCCTTCACGCGCGCCGAGC
TTCCAGCTGAGACCCTTTGCTTCTGCAAAATATCCATCCGTCTCGAAGGTCACAGGACCAAAATCCTTGGTGAAGCGACCAACCGAGAAGAGGTTGCGTG
ACAACTTGGGAATGTACCACACGTTCGTGAGCACACCCTTCATGGTCCCCCGTGGAGTCTTCATGGACATCACGATGTCGCCGGTCCCGACCGCCTGAAC
CACACCATCGTCCGCGAGATGCACGTCCACCGGAGACATCTTTTTGTAGTTCTTCATGTACCCCTTCGAGTACGTCATGTGCTGCTTCGCACCTGAGTCG
ACCAGCCACTTGTTACTTGACTTGGTGGTCTTGCTCCCACCACCAACCAAGAAGAGAGACTCGCCCGATTCTTCTTCATCGCGCGCGACGTTTGCTCGTT
GCGGCCTCTGCCGCTCCGCATTCTCACGAATCCTCACCGGACACTTGGCGATCCAATGTCCTTGTTCGCCGCAGTAGTGACACGCGCTTGTCTTTGGTGC
CTGTCGTCCCTTGCGCTTGCCGTTGTCACTCGTCATGAACGCTTGACCGTGCGCGGCGCCATCCGCACCGCCACCTTGCTCCTTGCGCTTCAGGTCCTCA
TGCAGCAGCCGAGCCGTCACGAGTTCCCACGACAGTGAGTCAGCTCTCGACTCCAATGCCGTGATGAGGAACTGGTACGACTCGCTTAGACTTGCCAGAA
GCGTGATCACCAAGTCGTCCTCGCTGACCGGAGCGCCCACTGCGTCGAGCTGTTCCGCCAGCGTCGTGATCTTGTTGATGTGCTCCAGCACATCATAAAA
GGAAGGTCGCACTATTGTACCCGCCATAATACTTCGGACCAAGATTTGACGGCAATTTACTCGTAGAAGATTATAACTTTCCATATACGATACTTAGATA
TATAGGTAAATCGCACCCGTAGATTCCGAATTTGAAGTCAGATTTGACGAATTCGTACTCCTTCTACCTCATTTTTCTCTTACAAAACGTCGTCTTCAAA
GTGCCAAAGTTTGGGGAAAGGGTTCAATTAGGTTTAGCCGATGATTCATCTATTTGCGACCCGTTCATTGGCTCAGACAACAAGCCACATGTCAAACATA
TGGGTGGTTAGGCTAATGTATTATTTGTGTGGTACAAACGTGCACGTCGGAATGAAACTTTACAAGTGTATCCAAAATCGTCTCAACAAAATTATACAGG
TCTGAGCTACGTCTCTTCCTCGTCATTGTCATCCAAACTTGAGATCTCCTCGACGTTGTCCTCCTCCAGGCCCGCGATCTCCTCTGTGTCGACTGCATCT
AAGTACTTATCTTCAACTTTCTGCACGTGTCTGTACTTGTTCGTCCAGCTTCTCTTCGGAAGGGCTAGCTTCGCATGTTCCAGCTTGGCCTCAAGCTCGG
TAATATTGCGGGCTGGGGCGCTAGCA