Description :
From Genome Similarity Track
Location :
contig_115:76641- 78519
Sequence
1878 bases(100 bases per row)
CAACGAAATGTCGGGTCTCCGAGTGATGTGACTCCAGCCCGGACACCACCTGTCTTGCTGCAAGATGTTTACGTCGATAGACTGGTGGCCTTTTCACCTG
AAAAGTCGGTGTGGATGAAGGCTAAGGTCTACAGACCTATTGGCACTGCGTACATCGTTGGAAGGGTGTGTCGTCAAGTCAAGAAAGGCAAATTTGCTTC
ATTGTTTCAAGTACGTTGGCTGGACAGCCAATTCCAGAGCGCCGTGGAGCATCTCAGTGTGGGTGCTGTCCAACTGGCATCAAGAACTACGTTGCCCTCA
CGCGAATCAAGAATCCCGACTGGCATGTGTTGACGGAGCCTGATTCTTCCGAAGCTATTGAAGTCGGTGATGCCGAGTCTGACCTCGTAGCAGCAGATGA
TCTCTACGAGGCTTTTGATGCATCGGAGCTTCTTCCAACCAGCCTGGACGAGGTTGAGGCAATTCGGAGCATGCGGTTTGAGCCGTCAGCGCACGTTGAG
GCACCTTCATATTTATATGAGCATGCCGATGGGACTACGAAGACCTACTTGCGTCCGGAATACAAGCACCTCTTCGATCACTCTGCGAGCTCCAGTTTCT
TCGCGTACCTTCCGCTGTATTTTTGGCGCCAAGTCCTCCACGAGACGAACCGTTACGCCGCTCTAAAAGAAGTGAAAACGTCTACGCCGTTCACACTGTC
GGAGCTGATGGCGTTCCTCAGGATTATGTTCTTCATGGCAGTCAACGAAAAAGGGGAGTACGCCAACTACTGGGGTCCCCAGCCGGAAGACCTTATTTTT
GGTGGGGCTACAACTTCACTAGACATTGTGATGACTCTAAACCGCTTCAAGTTGCTTAGAAGATGCCTGAGCTTCAATGCAACTCCGACGACACTCGAGA
AGGATGCTGCTGCACGTATCCGGCCCCTGCTCAACCTGCTGAAATAACCGGTGGGCAATACGTCAACGTCGGTAGGGATGTCGCCCTGGATGAGGCAAGC
GTAGCTTGTCGCTCTCGTCAAGGACGCCACCTCATCGTGTACAATCCCTTAAAGCCAACAGGGAAGTACCATTTCCGACTGTACATGATCTGCTGTTCGA
GCACCTGGATTTCATTGAACTACAGACTTCATTGCAACCAGAGCGACATCTCCGATCGCTTGCATGGTGTTATAGGCCAAGTGGAGGCACAGGATCTACG
TGAGGAGCTAGAGAAAGTGTCGAAGATTCGACAACACGTTCTGGAGGTGGCACGACCATTTTTTGGGTCCAACAGGGTTCTTAATATGGACAACTACTAC
ACCAGTGTTCAGCTGCCCCAAGAGCTTCGCCTAAAGGGTCTTTACGCGAGAGGAACGATACGAGCAAACAGCAAACACTTCCCCAGCCACACTATCCTCC
ACAAAGACGATTGCGTGCGCGGTGATCACCGGCAGGCTGTCTCCTCTGATCATAGCATGCTTGCAGCCTCGTGGTGTGACGGAAATGTGGTGAATATGGT
GTCGAATGCTGACGCGTCAACTACCACTACCGTAAACCATATGATAGGAAATGAGAGGCGAGCTTTCTCGGCTCCTGTTTGCGTTGCTCGATACAACAGG
AATATGCAAGGGGTGGATAGACTCGATCAAATTCGAGGACGATTCTCTATTGCGGACGGGCACTCCTACAAGCGCTGGCATAAGAAACTTGCCTTAGCGT
TTATAGATGTTGCAAGATCGAATGCTTACTTGACACGACGGCTGGCAAAGCCCGATTCTACTGCACGAGATCCCCATCGAGCGTTCGTCACTGAATTGGT
GGCCGAGCTCATCAACGGTCAGTGGGCTGAAGCGCCTAGCGAAGGTCGTATGCTGTACACAAGTCGTAATGCTGAAGA