Description :
From Genome Similarity Track
Location :
scaffold_8:76637- 95327
Transcript NameFunction/comments
g526.t1 U4/U6 small nuclear ribonucleoprotein Prp31
g527.t1 hypothetical protein PHYSODRAFT_293746
g528.t1 conserved hypothetical protein
g529.t1 conserved hypothetical protein
g530.t1hypothetical protein
g531.t1hypothetical protein

Sequence
18690 bases(100 bases per row)
TACTCTTGGTCGACTTGGGGGCAGGTGGACAATGCGGAACTGAAGAAGCCTGTCGCTTCAGAAGTTAAACGGTTTTCCACCAACCGACACGCTGCAGACG
GAAAAGACTTGTGTTTTGTATGTCGTAAGTCGCAATGGATGGAACTATGATATAGCATATTGTAGCTGTTTGTTTCCATAGATCTTATAAGATCGCGTCA
TTTATTCCATCAAATAGTTTCAAAAACAAAACAAATTAATTGCAATTTTGAATAACAAACGAATAAGACAGCAAGGAAGAGCGCTAAATATGTCGACACT
TGCGGACTCGTTCCTGGAGGATCTGGACGAGCTCAGTGGAGGAAGCAGTGATGAAGAAGAGACGCTGACGTCTTCCTCTCTCCCTCATGCCTCTAACGGC
CACACAGAAGACGATGACGCAGACGAACAGATGCCCGAGGCCTCCGAGTCTAGACCTGCCAAACGGAAACGTTTAGATGAAGACCAGACCCTATTAGAGA
AGAAGACCGATGACTTGGCCGAATCACTGCGCTCCAATGTGAAACAGCGTGGTGTGGCAGCCGTCGCATCGCTCAAACGTTCCCCTAAGTACCTGGCACA
CGTGCAGAAGATTCAGAAATACGTGGATGTGGACGAAACTACATCCAAGCCGCAGCCATTGGAGGAGGGAAGCCCTGAGTACGACCTGGTGGTGACATCC
AACGACCTGATGGTGCAAATTGACGACGAGATCGAAGCTGTGCACCGCTTCATTGCCGAGATCTACACTGCCAAATTCCCAGAGCTCGACTCGCTCGTGC
CCAATGCTCTTGACTATACGAAAGTAGTGAAAGCTATCGGCAATGAGATGGACCTGACACTTGTGGAAGAGCTGCCCAAACTGTTGCCTAGCTCGGCAGT
GATTGGAATCTCCGTGACGGGTTCCGGTACGAGTGGCAAACCGCTGGGTCCAGAAGACCTGAAGCCCTGCATGGAAGCGTGCGACGAGTTGCTGTCGCTG
GATCAGGACAAGAGCATGATCCTGCGCTTCGTAGAGAGCCGTATGAAGTACTTGGCGCCCAATGTGTCGCAGCTCGTTGGCACGCGTATTGCTGCTCAGC
TCATTGGACTTGCTGGAGGTGTGGCGCAACTGGCTCGGATTCCGTCGTGCAACTTGCAAGTGTTGGGGCAGGAGAAAAAGGTACTCAGTGGGTTCTCGTC
CGCTGCTGCGCTCAAGCACACGGGTATCCTTTTCTTTAGCGACCTGGTGCAAAGTGTCCCGCCGTATTTGCGGATGAAAGCGTGCCGAGCAGTGGCAGGC
AAGCTAGCGTTGATGGCGCGTGTGGATAGCCAGCCACACCAGAACGACACCGAAGGTTTAGTCGGTGCCCGGTTCCGGAACGAACTTGTGGGGAAAATGG
AGAAATGGCAGGAGCCCCAGAAAGCCAAGAGCAAGAAGGCACTACCTATTCCGGACGAAAAACCGAGCCGTAAGCGTGGTGGCAAGCGCTACCGTAAGAT
GAAGGAGCGACTGCAGATGACGGACGTACGGCGTGAAATGAACCGGCAGTCCTTTGCTACAGCGGATGAAGAGTATGGAGATAACGCCATGGGAATTACG
TCCGGCCGTCTCGGGCAGGAAGGATCTGGCAACTTGCGTATTATGCGCAAGGAGCAGAAGCAGTCTAGTAAAAAACTACGTGCGGCCAACTTTGCCGCGT
CTTCTGCTAGCAAGCCACCTCTTTCTGGCCTGGCGTCGAGCCTTGCCTTCACGCCTGTGCAGGGCATTGAGCTTATGAACCCCGAAGCAGCGAAGGCTCG
AGTTGCTGAAGCGAACAAAAAGTATTTTTCTGCAGCCAGTGGATTCGTCAGCGTTGTCAAGAAGCCATGATATCGATTGGGCAGTGGATAATGACTGGCA
TTTTAATCTTTCAATGGAGTCAACACTGTTTACAGTGGCTTTGAAGGTGTCGAGTTATTGTCGTGTTTGCATTCTTATGCTGCGTCATCCGAACTAACTG
CCTTTACAGATGCCCCCTTTTAGCTTCAAGCGCCTACAAAGTGACTGTACTGGCCAATTCAGCTCCTCGAATTTCCAGTGTCATGATCGATTGAGCTGGT
AGATCTGCTGAAAACCTGGCACTTTGGCCGAAGAGGATGTCGAGACTGGAAGTCTTGTACACAGCTCCTGCGGTCGTGTTAGGCTCAGTTGTCCAAGTGT
TGATCGGTCCATCCGCACTGGCAAGAGCCGACAAGTCAAACGTTATTGTCTCTGCTTCTCCCAGGTTTGTCGCTACGATCACCAGAACTTTGGTGGTTTT
GTCGTAGGCCACGACAAAGTTCGGGTAAATATCCAAAGCGTACTCGGATGAACAGGAAGCAAAGTGTTGGGGTCGTCAAACTTGAGGATCGTCATACCAG
CACGGATATGACGAGAGTAGTGAGCCATCACGTAATGTTTCGGGTTGGCAGTGCCGATCCATTTGTCCCCAGGGTTCGATTGAATGAGTCCCACCACTCC
ACTGTCGAGGGCTTGTCTGTAGACGAATGCTGAGGCTCCCATTTCGTTAATATCTTTGGCGATAGTTTGAGCCATGGTGAGTCCTGTACCGTCCTCGTCG
GCGTACACCGAGTCCCAGAGAGGCTTGGACGAAATGACTCCTTTGAATTGATCGCGGTTGTCACCGGTATACGGAATTATCCCATCGGAACAATGCGTGT
TAATCTTGCCCATCGCGCCAAGCCCTGGCATTTCATCAGGAATCATACTCGTCAGGATAAACACCGAATCGTCAGGGCTCTTCTCCTCAGCCCCCGAAAC
GACCACATTCTTGAGATCGAGTTTATCCAACTGCGTTCGCATCAACGTCAAGATGTCGCTCTGCGTCTTGATTCCCAAATGACAAGCCTCCTGAGACTCT
GGAAACGCCCTAGCCTTGCTGTTCGCCTCGTTGAACGGTGAAACGTACTTGAACTCGACACCCCAGTCCGCCTTCGCCTTGCTCACCACCGTCGCCAAAT
ACAACGCAAACTGCTCAAAGTACTCGGCTTTGAAATTGTCAGCAGCTCCATCTTCTCCACCAGCGGTGGCGTGGTTGCTCGTCATCCACCACGGAGGTGA
GTTTGAGTACGCCCCGAAAACGTCCGCGCCTCGCTTCGATGCTAGACCCAGCATGGCTCGCTGGTTGGCGTCCAACTCCCATTTTCGACGCAGGGTCCGT
GCTGGCCCAGTCCAACCAGAACGACTCGATGGCCTTGAACGCAGGCATCTTGTCGGACGTCTTCATCGCGATCTCCGTGCCGCTGTCGTCGATGACGTTG
CTCCCAGAGCCGCCGATGTTGTAGCGCGCGATGTTGAAGTCGAGTGCGGGGATGTCTTTCGCAGCTCCGTCGATGGAGACGGACGACATGTTGGTGAAGA
GCACGTGTGCGATGTCTTCACGGTCTCCAAAGACGTTGGCCCACCACGAGAGCGAAGTTCCCCAGCCTTCCCATGATTTGAGATGTGTCGTAGTCGTTAT
TGAAATTTTGTAGCCCGAGACAGTGTGCTCAATAGAATCAGTGCGAACGCTGATAGAAATTCCGCAGCGAACATTTGGGATGATCTTAGGTGATCGGCTT
CGTGTTTAACCACAACTTCTGAGCCGTACCAAAAGCGAAAGTGCGGGATTTACACGGAGAATGCCAGCCTGGACTGCAAATCTGTGAAAGGTTTGGTTTG
GCTGTAGACCCACACAAACTGTGTCGATGTACTGGAGCGTAATACCAAAGTCACGCCCCATGATTTCGTCAAGAGATACGTAACCAAGCTGTCAGCTGGC
GATAGGTTGATCATCAACTTGATGCGAGGCAAAATTTGCTTCAGGAATCTGGAGACGATTAAGGCCTTATAACGTGAAATTCAAGGTCTTGGAGGGGAAG
CGTTTCCATAGCCAAAATCGTATGGAGCTTTGCTACTGTACGTGTCGAACTTCTACTCGAAGTACGCGTTGATCAAGCATCTTGGACTTGCAGTTCATGA
AAGCAGTGGTGGCCTTAGGCCACTGGCCTGCAAGTACGTCGTAGGTTGTCGTCGTCGCATGGAACGTGCTGACGTTATTGCTTGGTACACAGTATTGCTG
GCTTTCAGCAACAGATCATCGCGTAAGACATGACGTTATAGCTCCACTGATTTTCAAAATTGTCGTGTTTCGCTGTTGCGTTACAGCTGCTCCATCCTGT
GGCAATCAAAGGAAGTACTCCTCGTACTTTTGCTCGTAAATGATGCAAAACCTCCGGTCGGGGGTACGACGAACGCGGTGTAAAGTGCCCGGGATGCGGC
CTTCAGTGGCTCGATTCAAGGCGTGACCACAGAAGAGCACAATCTCCTTGCCGGGAACACATACTTTTTCAGCCTGAAGCCACTTCTTGGAGTGCGGGTC
GTATACATCCAATCCCTCCACACTTGGCACAGGTTCCACGACGTAAAGGCTCGGATCCACATGCTCGAAAACATTTTCTGTCTCGGATTGGCCACTTCCT
TGAATGTTGGGGTAGTGCAGTCCGTAGCACACCGAAAAGTCCTTGTCTGAGCGCGAGTGGCTCGGCTCAACGTCGTAGCCGACCGTCAAGCTCAGAGCCC
GGTCACAAATACGCTGCATGCGGCGCTGCAGAGACAGCCAGTGGTTCTTAAATTCGGGCGACGGCCAAATGAGCCTCGACATGTCCCCGCAGGCCACACG
GAAGCAGTCACGCACACTGGTGTGCTCATATCCAGCGTACCAGAAGGGCTTACCGTGCTCGTTGAGGTACACTTGCTTGCTAGTGCAGCCATTCTTCCAA
TCCTCATCGTCGCTCGTGAAGAACGTCTCGAAGTCCTGCAGCACCTGGTCGTGAGTACACTCCAGGCTTTCACCCAGTTCCGTGAGCACCACAAACGAAT
GACGCTGCATCATCTCCAAGAAATGAGCGCGGTTCTTCCAGTTGAGCTCGCTTAGAGGCAGTCGTGGCACTTGCACCGCATCGTTTTTAGCGGCGTCAAT
GGGCTTGGTCTCGCTTGGCTTGGGAGACGCCACGACGTTGTTGTCTTGGGAAACTTCGCCGCTTGCATTGAGACAGTAGTAACTGGCTGCGAGGCTGTAG
CCGGTGGGGGAGAAGGATGCAGCGGACGTGGCTGTCATGTCGGTGGTGGTGGGGAGATTAATTCGCGCGTAGAAACCTCAGTTCACGACCTTTGCTTTCA
TGTTTTTGTGTCAGAAACCGGGGACCACACGTTTTGCGTGCTCTCAGCCAATCGAAACGCAGTGATCGAAAAGTTCAAGTCTTGGACCATCATTCTGGAG
AGAATTACACTTGGCATTCCTGCTTCACAACAAGGCTTAAATCAAGACTGGAGTCCGTCAAGTATGAATAAATTTATGGTATAAGTTATCGTGGCTGGCG
TGGTAGGCACGAAAACATGCAGTGAGAGTATACGCAGGGGAGAATTGCTTCAGAAACGAGAGTGACTTGAGGCTGAATGCCTTCGCGGTGCCGCTCCCTT
CGTCTTGACTGCGTGCGATTGGTAACCAGTTTGGTTGTCTTCCTTGTTGTCAAACAGGCGGGACCGCACCTGATCAAGGCGACCTTGCCACTCCGGAGTG
CGTGGCTTCTGTGTAGCGTTGGTGTTCAGGTGTTTAACCTTGCTGGCAGCGAGATTGCGGTTGCGTTCTTCCAACTGGCGCCGACGTTCCATGTTCATGG
CCTTGGTGGCCATGAAGCGTGGAGAACTGTCATAGTCCATGTACCGAGGGACACACGACGACTTCGAGCGGCTTCTCACACGAGGAGATGAAGTCACAGG
TGGGGGATCACGTGCCGAGTCCGAGAAACGGCGAGCTGATATGGCGGTGGCCGATAGAGAAGAGCGCCGAGGTCTCGCTGGTGTTGGTGCAAGTAAAGGC
TGGTTTGGATGCGACTTCGGTGCCGGAATTGACGAGTGCTTCGTCGACACGGATGACGGCTTTCCGGTGAGTGAAGCTCGTCGGTAGGGTGTCGGCGGAA
TCAACTTGGACGTTCTTGTTGATTGCAGGGTTTCAGGCAGCGACGAGCGTCTCGAATGGTATGTTGTGTGCTTGCTACTCCTGCAGATGTCGGGGCTGCT
TTCACGCGACGCCAGCAGCAGCTCGGGCAAGAACATATCCAATGAGCTTAGAAGAGAGTCCAGTGACCCCGTAGAAGTTGTTGAGTAGGCCGATGGACTA
CACGGAACGGTCAAGTAGCACCTGGGCTTGGTCGTAGTGATCGATTCTGCGTCGCTCTCGTTTTCGTACGTGTTGAAAGTCGTGGCATCACCTTTGTCGA
CAGGCAAAGAAGTTTTCACGGTGAGCCTTTTGTAAACGTCACGCGTCGGAGTTGTTAACTTAGCGACTGGGATCTTCGGTTTCTTCGCTTCCGGCAGTTC
GCGCTTTTGAATCCTTTGCATGGGCTCCGGCTGCGTGCGAGCGCGTTGTGTGTTGATGCGGTTGATGATCTCCTTCACTGGCGAGTTGTCGGATTTTGGC
TGTGGTGGCAGCTCTGTCATCGTGTTTCTCGTCACTGACCATGTGTGTGGTGCGGCTGATGAGGCGTTGACCTGTGCCATGAGCTCAAACTGGCTGACAA
GCGTCTGCACGTTCGTGTTGCGGTCCATCGTTGTGTGTGAACTGATTTGGACCGGTGACGCGACTAAGATGCAAGCGTTTCTCAACTGAATCAATACCAA
TTAGCTGAATCTCGTTCCCGTAAGCCCTCGGGGGTGAAAGCGCAAGTGGTGAACGGCTTGTGGCGGTGGACACGTTTGAAAACGTGCCGGGGTGCTGGCC
TTTCCGGTCTCCTCTCCAGTACTGCCTGAACGCCGGCCTGGTGCCAGCCAACGTCGCAAAGCGGGCAAGCCTCCGGAGGCCGGCATTTTCCGGACTGCGG
TATATAAAACGCTTGGATTCAACGATGTTGATGGCGCCGTTTCGAGTTTGCGCCAATGGAAGAATTTACAGCTCTGTTTCAGCCAATAGATGCATATCAA
ATTTGATGCGTCCAGCGACATATGGTGCGACAAAAATTCAATTTTCGGCCAGTCCACAGTTTTGAAACGGCCAATCAGCGGAGCCTGTCACATTCCAGAA
CACGACATGTCCGAAAGTCAAGTGAATGCAGCACCAACCTACATGTATCATTTCGTCACGGTTATTTCTTGGCAGAGAACTTGTCGCCTTGAAACGCTAC
ACGTGACTTCGATGGTCTCCGTGCAGCTGCATTTTGCGTGGCAACAGCACCAGAGTCCTCCGCCTTGGTGCCAACTCGGCACCACGTTCCTACAAACAGG
CGCCTACATTTACTAGACGTCGGACCTCGCCGCGTCGGAACTCGGTTTCTTGCGGCGTTCTCGCTCCTTGCTAATCTGCTCCTGCACGAAACGCCCAAAG
GATTCTGCCAAGTCGTCGATGCGCTTTTCATGCTCGTGGTTCAACGCCGATAGCTCGCGCTCCAGCTGCAGCACCTGGTTCTCCAGAGACGTTATGAGCG
TTGTCTTCTCCTTCAACACGACTGCATTCTCCTCGGTCGCGTTCTTTGCGCTCGTGGTAAGGACCTAGCAACGATACACGTAAGTACAAGGCGATGCGGG
AAGATATTTCACAGACAGACTCACCTGGATCCGTTCGTCGAAGTTTGCCTGCATCTGCACGAGTCGGTCATCCTGCTCCTCCATCTTCCGCACCTGGAGC
TGCAATTTCTCTTCGCAACGGGAGCGCTCGCTCACTGCTGCAGCCAATTGCGTCTGCTTCTCCTGTAGCGCCCTGATCTGCGTCTCCAACGCGGTCTCCA
GTTCGTTCTGCTTTTCGTCTCTCGACTGTTGCAACGATACATTATCCTGTCGAAGCTGAATAATGGTCTCGAGGTGTTTTTCGACCTCTCGCTCAAGGTG
TTGGCGCGCTTTCTTCACCTCGGCAACTTGCGCCTCGACGGACCCGACCGAACGCTGGATACGCTCCTGCACGTCTGTTTCCCACTGCTGCTTGAGATCA
CCAATGAGTTTCTCGTGGTCGATCTGGGACTGCAGCAGTTTGGCTTGCAAAGCTTCACCTTTTTCTTTAAGCTCTCGGACGCTTCGCTCGCTGGCTTCGA
GGTTTGTTGAGGTGTAGCTGAGCTGCGTCTGTAAAGAGCCAAGAACCATATGATGCTGTCGCTGGGAGGCGCTCAAGCTGCCTTCGTACTCCGATACCAA
CTTACTTTCTTTGCGAGCATACTCCTGCTGAGCATCTTGAAGCTGCTTGTGTAGCTTCCCAACCTCTTCTTCTTGTGTTCTATTCAGCAAAGAGTAAGTC
TTGTGTGGTAGTGACATGATCGACCTGCTGGTCTACTTACCGTAACGTGAGAGACGTGCGGTGCATCTCGTTGTCGAGCGCATACTTGGCCTCTTCCAGC
TGTGAGATCTGCTTATCTTTTTGATCTGCTTCCTTGCTGCGCAGGGCCTCCATGTGCCCCATCTTCTGTCGGACAACTCCATTCTCCCGTTCGAGAGCTG
TTCTTGCTGATCGGTACTCTTCGAACTCCAGTTTCCTAAGGTTTTCGAGCTCGTCCAGCTGCATCCTCAACTCGTGAACGTCACGTTTTGCATCAATTTC
CCGTTGCTGGTAACGATCTCGCTCTTCCTTGGCTACTTCAGCGTCCTTACAACTTTGCTGCAGCTGCATCTCGAGCTCTTCCGTCCTCTCCACCATTTTT
CGGCGTTCTCGTTTGCCTAAATCCAGTTCCGTCTCCAGCTCCTCCTTTTCCATTAGAACTTGCAACAACAATTGATCGTCGGGGGCAGCTTTGGGGCTTC
CGTTGTCGGATCCAACCTCATCATCATTTTGGCAAGACGCATCGACTGCAACCGGCGATGGTCTCTCTGCAAACGCTCGATTCCGAGCCAGCAACACCTC
GATCTCGTCGACGTGCTTCAAGCTGGTGTTGTTCCCCATTAGCTCCAGCGTCACCAGCGAGTGGTTGCTCTGCAAAGCTTCTCTAAATGCCAATACCCCA
GGATTCCCAACCTCATTCCAACGCAAATCCAACTGACGCAGTGTGCGATTCACTCGAAGGGCTTTTGCGAGAGCCTTGGCACCTTCCGGCCCAATGTTGT
TGTTGCGCAAGTCGAGGATCAGCAACCGCTTGTCCACTTCTAACGCACCAGCGAGAGCCTCCACGCCCTGGTCGAGAAGGCCGATGTTGTTCCATTCGAG
ACTGATAGCCACCACGTTGTGGGGGGACCGTATCAACATCGCGAGAGCTCGAGCAGCTCCAGCTTCGAAACAATTACCACGCAGATCTAATCGCGTTGGG
ACGTTCGCGAGACGAGCCTTCTCGACGATGGCTGCGAACTTATCATCTCCCAGGTAGGAATTACTGTAGTCCAGCACTGTGCCAACAGCTTTAGTGATCG
AAGCCGGGTGCACCAATGCGGCGGCGTCCGAGTCCTCGTCGAGATGTTCTCGCTTCGGTGGTGTTGTCATCAAGGCGCAAGTACTGCCGTTTCTGCGGTG
CGATCTTTAGGAAGCAGTTACTGAGGCCATGAATGTCTCTCATGGAGGCTGGCAGCTTCCTGCGTTGAAGCCCGTTGGTAGGTATCAGACCCAAACGTTT
GCCGCTAATTGCTCCGCCTCATGTAAAAGATCGAATTCAAGTTTCATGAAGGTGCGGACTGTAAAAGTTACAGTGCATGTACGGATGTCGACGAGTATAT
ACACCATCCAACAGCTCGATATCCTGTGGTGCTTGTTGTAAGCTCCACTCTTGTTAATCCGATCGACTCGATCAACGCCAAAAGTACGGACAGGACAGAT
CCAACAACTGGCAGCTCGCCCATGCGCAGTTTCCAATATTACATTGCTCTGGCGGTCAACAATGACGTCCTGTCCGAATTCTGCCGGTCCTCCCCCATGT
GGAGCCCCAAACTCAAATGGCAGCCGATCAATCGTGGTTGATCTCGGTCAAACCTGGTCAACATTGACTCAAGACTCGAAAGAATCCACTCCACTCGTTC
TGTCCAACCTGTTCCGGACTACGCTGTCGATGTCTGAAAACTATCGGGAAAGCTTCCTTGGACGCTGTGGTAATGTACCACTGGCACCTTAGGATGTGGA
CGCCGCTAATGAATTTCTCGTGTAACTACGGAAGTGTGCAATACGCACGTCATAGTGATTCGACCGGCTCGAGCCCACAACACGATGGCAATTGAGCGTT
GATAAATGACATTTATGGGATACCACGCCACCTGGACCCCTGTCGTGCATAGCGGTGTGTATGATGAAGCAATTCTGACCACTTTAGTGATCATCTTCCA
CCGGTACAAGCGGGAAGAGAGCGCTTCCCAACATGTGCGTTTAGCAGCCATACAGCTGGATTGCATATCACCGCTCCTCTGCTCTTGAAGAGGCTAAGCT
GAATCAATTGGTTGCTACGCTGCGTTCGTTACTACGAAGCAAGGAATCCACCTGGACAGGTAAATATAGGAAGTCGAGCCAGCCCCACCCTGCCTCACTT
CCCAAGACGCCGCATAAGTGCCAGTCTCTTTAAGTTGATAACTCGATGGCAGAAGCTCCTCTAAAGCTGCGCTCACGTATACAGGAAAGTCTCTCTGGAC
TTCAATGCGTGGATCTTGTCGAGTGTTCAGCCTCAGGTCGGCTATTCATCGACAAGCATACCCTCATGACGTCGTCCACGTTTGAAGGTCGTCGTGCTAG
TGCTACTGCATTGCACGAATTGGATCTGCACCTCTCTGTTCGTGACGTCGAGAACGTTGTCAAGATGGAGCGTCACTCACTGCAAGGAGAGCGACTCCAC
CTGCTGCACGAATACTGTGCAGGTGGAGATCTCCTGGAGATCATGCAGCAAGAAATTCGCCTTCAGACGGCCGGTGTGAGCTCTCCGGTGACTACTTGCA
CCGATACCGGCAGGCGTCAAGTCTTCACCGCAGTACTTCGAGGCGTGCAGGCCCTCCATTCGACCGGTATCGTCCATTTGGATCTGTCACCAGAGAATGT
TTTCGTCTCGGAATCCGGCGTCGTGAAGGTGGGAGATCTGGGCCACGCCCAGCGGTTCCAGCTCGACCGGCCAAGCGTCCAGGTGCTCCAAGTTGCTAAA
GAAGCTTATGCTGCGCCGGAACTGCTACGTTCCAGTAAGATTGATGACGCATGTAGCGCTGACGCCTGGTCACTTGGTGTTATGCTGTGGACAATGTGCA
CCAAACGAGGTTTGATGCGTCGTGCTTCGACTGACAGTGATAAGCTCTTCAACCGAATGGTGGAACGTGGCTCGGCGTTCGCTCTCCACGAGACTGGACT
GCTATCACAGGTGCCAGCTTCATGTATCGACCTCCTTGCTGGTCTTCTCGACGTGAACCCCAAGTCGAGGCTTTCAGTGGCAGCAGCACTTCAACATCCG
TGGGTCCAGGAGGTCACAACCAAGAAGTCTCGACGTAAGTCCATCGGTAACATGATCAAGAAGAAGGGTGAGGAGTTGATGAAGAAGCATCAGAGGCCAA
GTGAAAAGAAGACGCGAGTTCGTACTGCCAGTGCTGAAATTGCGCTCGAAGTGACTCGTGTGACTTTGACATCTCGAAGTTTAGCTTAGAGGTCAACTAA
AATCTTCCTACTCGAGTCCAAGACACGCTTATAAGCACTCATAGCGAGTGTCGAATCCTATAAACGGGGAAATGAAAAACGAAACCAACTAACCACCTTC
CGTCCTTCCAAGTCGTCGCACCGTCAGTCCAATTAAGAACGGGCTTCCGAGCTCCGATGCGGAGGCATTTCGTCTTCGCCGAGGACGAAAAGGAGCGCAG
TGTTGGCGAAGGAAAGACCAATTTGCTTCAACTATGGCACAACCGTCGAAACGCCATGCTGGAAGGCGACGAGTCTGCCAACGGAGGCGAAGCGAATGCG
TTGGTAGCTGGAGAATTGACGTTGCTCTGGGATTTGGCGAAACCCATGAGCTCCTGCACTCTGAATCGAGACGGATACGTTGCGTTCTTTGCCCGAGCTG
CTAAAGCGCTTATTCTGCCGTTATCAGTCGATGCAATCGCCATCGCCGCAGCGCAACGGGACTGGGAATACGACTTGGAAGGCGTCGGTAGTCTCTCTGA
AAGTGACAAAGCACCTCCCAATTTGGACAGTGAAGAGATGGCACCCGAACAATTCCGTGAAGCTCTCATGCAGATTGCAGAACTTGTTCTACCCGTGGAG
AGTGGAGCCACCGTTTATTTGACTTTCGTCCGAGCGTTACGTCATTCTGTCGCGGAGATTATTTCTCCATCCAGTGAACCGGAACAGGATGAGGCCAATT
CGGCTGATCCAGTTGATCGATTCACGTTGAGACCGTTGAATCGGATCCCGAAAATCGCCAACGATTCGTTCCTGCAAAAGCTTCCTCCGTCAAGCGATGC
AATGCGAAGTATTCGGGGACTGCAGCCTGCGGATCAACGCGAAATGTCGCTCAAACAGCTTCTTGTTAGCTACAACCCGCGGAAATTCTCACTCACCCGT
GCATTTCCGAAAAAGAAGTCGAATGCTACAGAAGAAGGTACACCGGAAGCCTCAGATACCGCTAAAACTGCTGTAGAAGACGATATGGAGCTTGCAAAAC
GTTTGCATTTGGAACTGGTGGGTTCTATTGGGTCAGGAGCGACTCCTGTTCGAGGAAGACAACTTCATCGTGAGACTGCAGCTCACTGGGACCCTGAAGA
TGCTCTCGTTGCTGCTTTAACAGAGTTTCCAGCTCTGAAAGTCGCAGTTGTTGGACCACCTGGAAGTGGCAAGACGCGGCTTTCTTGTGTTCTTGCACGA
CGCCTTGGGCTCAAGCATTTAACTCTCAACGGAGCTGTTCAACGTGCCGTCGACCGTAAACTCCGACTTCGTCGGCGTCGAACAGTTATTGCTACACCAT
CAGAAGAAGATGCAAATGCCGAAACACCTCCACCAGCGGAAATACCATCAGAAGACGAACAACCTGAGGAGAATAATACGGAGGTGGATGAAGAGCTCGA
TTGTGTTTTTCGAGAGGAAGATCTCAATGCAATTTGTTCTGGGAATGTCCTTCCAAGAAGCACAGCACTTGCTTTACTACGACTAGAAGCCAATCGCTCT
TTACTTGGTACGTAAGTACATCACGATAGCAAGGATAAATGCTGCTCACGGGAATGTGTGACTTTGTTGTAGCTGGTGTTGGGGTAGTGATGGACGATGT
GTACCCGAGCGAATTGTCAGAGGACGTCAAGCACAGCGTAACAGTAGACTATTTGGTGGCTCTCACGGCATTACCCAGTGAGTTGGAGTGCCAACTTCAA
GCCGCGGAGTTAGCCCCAGTAGCAGGTCGTTTGTACTCAGCACGGGAACTTGCAACATTGAAGACGACAAGCAACGAGGAGTTGGCAGCCCAAGGCTTCG
CCGATTTCCTCTTGCCACCAAAGAAGTCAGAGGAAGAAACTGAGGCAGTGCCAGAGCCTATCGTAGTTGTTGAAAGTGGTGAGGCCGATTTAAACGAAGA
TGAAGAATTGGAGACTCCCCCAGTAGACCAGGAAGAGAACGGAGACGGCGATCAATCCCCGACGGAAAAGCCTGTTCCTCCACCGGAACCAACGCCTGCA
GAACGCAATGAGATCAAACCGCCCAGAGAACCCACTTTGCCCATTGGCGCAATGTCTATGGTGAAATTTGCGAAAGGATACCACGCGTATGTGGAGCGTA
TGCAGCGCGAGCTCTCCACTTATCGAACAACCAACGTGCCAAACTACCACCTGGTGGTGGTTCTGGCAACTCAATCACTCAACGTAATCCGAGACCACTG
CATCCGGGCAATCACTGGGGTAAGGAGTTTTTCGTCCTCTTCTTCAATCATCGTCTAACTCTTGTGCTTTTTAAATCGTTCAGACTCCTCTCGGTTTGTC
GCGGTTCAGCGTCTCGCGTGAAGCTTGTCCGATCTCCCTGCCCGAAGATTTAACTGGTTCCAGTCGTAGTGAAAAAGTCAAATGGTTGCTGTATGGAGAC
TGGAGTACGCTTCTTGAGGTCGAAGCAAATGCCACCTCAGAGTCATTCGCACGGCTGCCTAAACGTGACGTCAAACGCCGCGTTCTATCAAAATGGCGCG
AGTTTTGCCCTGTGCTGTCGACTTCAACTAACACGTTGAAACTCGGCGAACCGGAGTTTGCTGTTTGTTATTCCGGGCGAGTCTACCTTTTCACATCTCA
AGCCGCTCAGCGAGACTTCTGTGCCCACCCACTTGAATATTTGCGCCGAGATATCCCAGTGCCATCCACACATCGAACATTTTGGCTCGTTACCACAGGA
GCAGGCGAGATCTTCACACCTTCCTACCTGGAGACACTTGTGTCCGGACTCCACGTACAGACCGTGTCTCCTTCGAAGTTACTCAAGACTTCACCAAGTA
TCTCCATGGAAATGCGGCTCATGGGCGGACAGATCGTCTCCCATACTGAAGCTGCAACAGTTGTAGCCGAGACGATCAAGTCGAAACTGAACAAGTCCAC
AGGGTGGATGATCACGGATCTGCCATTGACGCGTGAGGTCGCCGCTGTGTTGCTTGAACACGGTTGCGTGCCGGACGCCATTTTCTTGATGGACAGAGAG
GAAGAGGATGGAAGTATGAAATCCGACGCCACTAGTGCGTTATCAGTGCTGCGACGCCAGCAATTCCAAGCTGAAATGGCTGGCGCGGAGGAAATTGTAC
TAGGGCTTGGTCGCGCTCCTCGAGTCATAACTTGCCCGCTATTCCATCAACCAGGCGATTCACTGGCAGCTATTGAGCGAGAACTGAATCCAGTAGCTCC
TCGGGTGGACAGAGTCGAAGATGGGCATGTCCCAGAACTTGTCGATGAATACGACCCAGTCGTAATATTCGCCCCACCAATTCCAGAGAAGGAGAAAAAA
GATAAGACAACGGAGGAAGAAGAAGCCACAGATCCTGAGGCGGAAGCACAAGACGAAGCAGCGAGGATCAGAGCCATGCAACTTCAGGGAGAGTGTGGAC
GATTCTGCCCTGTGTCTTGGAGCACGCGTGGCTTGTTGGTGCCTGGATTGCCGTCAAGCGTTTGTTCGTTCCAACAAAAGTTCTACGCCTTCGCTGGTGA
GTCCGAGAAACGTACTTTCGAGCGGAATCCAAGCGCCTTCATCCCCCAAAATCCGTGTGCTACTGCGAGCTTAGTTCCCTGTGTTCTTCTCCTCGGTGTT
CGAGGTTCAGGGCGTGGTCGGATTGCTACAGCCCTAGCTCAGACGCAAACTGAACAAACCGAATCTTCCTCAGCGTACGCGAATGTGGACTTGGCTGCAG
TGGCGGGGATCACCGAACGTAACCAACTGCTGGAAGAACTGAAGTCGGAAGAAATACGCTTGACGCCCGAGGAAATTTTCGTACGAGCGCTTCAACTCCA
GCTTCAACGCCAAACCACATCCAAAGCACTGATTATCGCCGGGTTGGGACCAGAGGCCTCTCGAATTCCAAGTGCCGCTACTTTGGAGATGTGTTTCAAG
AACGGACTCTTTCCAACACTTGTGGTGCCTCTAACAGTGTCGGAAGAGGACGTCGTGGCCACTTTGCTGACTCGGTGGGCTGCAAACCTGCCAGCTCCTC
GACGAAAACTTGCCATCACTCGGAAACGAGAAGGCGATGATGAGGCTGAAGACGATAGCCCTCCAGAAGCTGACGAAGAAGGAGAGGAACCCATCGACTT
GGAAGCTGCGCGAGAAGAAGAGACTACTCGACTGAACGAGCAATTTTCCGAGGACCAAAAAGCTTTGGATGAGGCTCTTGCCGACCTTCGAGCACGTGGC
GTCAGGGTCTGCAACCCGGTAGACGCTTCCAAAGCACCAAGACAAGTCGTCAAACACGTGAGACGACTCCTTGACGAGTTTATGGCAGGACGAGACACGC
TATTTGAGCGCTGTGAGGTTCTTGACATGACAGCGGCAGGTAAAACGCATCAGATGCTAGCATCAGGCGAGCTGATTGTCGGCAAGCATGGATTCGCTTG
CCCTGTTACTGGACGCAGGGATTCATTACTGGCTACTGATGTAGCGCCAGTTGTTCATCGAGACCAGCTTTACTTTCCAGGATCGCGTGAAGCTTGCCGT
TCTTTCATCTCTTGTCCTTGGAGATACTTGAACTCAGCAAGTTGTCCGCCGAGGCATCAACCAACCTGTTGTGTGGTAGGACCTCCTCTTTCAGGCAAGA
CACGAGTGGCTCAGGAGCTGGCAAACGCGCTCGGTATGATCTACGTCTCGCCCCAATCGGCTATAGACTGGGTGATTCAGTGTCAGGGTGGCTCAACGTT
GCGCCTTCAACTACAAGAGCAGTCCGACCCTCTCGCCAATCCAGATATCACGCATGAAGCTGTCTGCACGCGTCTTCGCTCTTCAGAATGTCAGGCGCGT
GGCTGGGTTCTGGACGGGTATCTCTTGCAGCATCATGAGCTGCACCGAAGTCTCAACTCAGGGTCGCAGAGTATCCAGCCAGACATGCTCTTCATCTTGG
AACGCGGCTTCGCTGGCGTCTGGCAGGAGCATCAGACTCATACTGATAGAACCGAGCTGCGAACTGTCATCTCTCGATGGCACCATTATCGTCTAGAGTT
ATTGCACACTTGGACCCAACGCTTCGGCATTTTTCACGTGCGACAGCTTGATAGCTCAAGCAGCTCGCTCTGGCACATAGCTGCACAAGCCCAAGCGCTC
CTTAACGAGCAACAACGCCTGGCATCGCACCATACTAGAGCAATGGCTTCCAGTCGAGCTACTCACTTGTTAGGTGTGGTACGCACTCGTGAAGAGCTCC
AAGCGCGTCAGCACAACGTTTTCCAGACGTTCTGTCCTGTTGAACTTCGTTCGGGGAGGTTTTACCACTCGCGTCCATCCAAACGCGATCTGTGTGTTGA
CTTCCGAGGCTCCAGCTTCTGGCTTGGGAATGAACGAAATCTCCAGCAGTTTATGGAGAGCCCTGAAGCCTTCATCGGGTACTTGCCTGATCAATCTCCA
GTTCAATCAGAAGACGAAAGTTGGCCGACGCAAGAAGAAGCGGAGAGCGAGGCACAGACACTTGTGGATAGAGCTCCAGTCAATGCTTCGCTCGTGAGCT
TGCTAACTGTGCCGGACTGCGATTTCCCCGAAATGAAAGGCTACTGCCCAGTCACATTTGCGTCGGGCTCGGGCGCCAAAGATTGGGCAGCACTTCGTCA
TGGTAACGTCTTCTTCCGCGCTTCATATCGTTCCAAAGTCTTCTTCTTCGTTTCTGAGGACGTCCGTCGTAAATTCTGCGCTGAACCATCTCGATACACT
TCACAGAGCTTGCCAGTGAAGTTACCACCCCAAGTGACACTCGCCAAGAGCTATCCAGGTCAATTGGAGCAGCACCTGGGAGCTGCTCTCAACGAGGTGC
TTCTTGCGCTCGGCAGCGAGCGTCCGAAGTTCCCGCAAATGTCCACGCCTTCATCAGCCTGCGTCTTCCTTGGCCTCTCACTCAAGGCACTGCGTCGCCG
ATACCAACTAAAGATGAAGCCTGACCCCCGCTCTGCTCGAAATGAAGACGAACCGGACGAGGAGCAGAGGCAGCGACAAGAACGGAGGCAGGAGCAGGTT
GAACAGGAAGCCATTGCACGTCGTGACGCCTTCGTGAATGACTGTCGACTGGGAGAAAAACTCAAAGCTGCCTCGACACCAACGCATCCATCCTGTGGCT
CAGGCGTCAAAGTCGCTCGCAGCATGCGTGCAGCCCAAGACTCCCTAGCCGATAGTGAAGTAGATGGCACTCACCATAGTGGACCTGCCAGCGAAGACAT
CGAGCTGCTTCGTCATCGCTTCGACGCTATCGTCGCCGGCAACCCCAGTGACGACAAGACACTGTCAGCAGATTCAAACACAGCACGGATGCACGCGAAA
ACTGCGTTCCTTGAGTACGCAAAAGCTTCTACCTCTAGCTAGGGACACACAGCAGAAAAAGAAAAGAATCCACACAAAAACAATATCAAACCAGTTAATT
CCAGCACGATATTCTACCTTGTTGTTCGTCCACTAGCGCTGCTTCTGCAACAGAGGTGTCGCCTCAGTCACGTCTATCGCCACGTGATTTTGCTCCAGAC
CCCAGTCACCACCGAACGGTGGCTTCCAAAGGTTTAGCAGCAGTGAGAACAGGATCACAGGCACGGACGATAAAAGCTCCGACAAACCAGCGAGGGCGGG
AGGTATCCAGATCCCTAGGGGAGCGTACAATGCACCACAAGCGATAGGCATCAGGAGCAGGTTGTACATGAATCCCCACGCGAAATTGTGCTTGATACGT
CTGTTGGTAGCATTCGAAAGTGCGCGGGCGTTGAGAAGATCGCGCAGGTCATCCTTAACCAGCACGACGTCGGCAGCGTCCAGCGCCACATCAGTTCCAG
CTCCGAGTGCAACACCGACATCAGCTGTAGCAAGCGCTGGGGCATCATTTACGCCATCTCCAACAAAGGCAACACGCAGACCCAAACTTTGCAGTAGGCG
CACCTTGTCTACCTTTTGATGAGGCAGACTCTCAGCCAGCACTGAGCCTTCAGGTACGCCCAGTGTTCTCGCCACACTCATCGCCGTTCCACGTTGATCA
CCAGTAACAATCCACGACTGGATTCCATCACGCTTCAGCTGCTCAATTACACGCTTAGCTTCTGGTCGTGGAGCATCCCGTAGAGCAATC