Description :
From Genome Similarity Track
Location :
Scaffold_1:76632- 106886
Transcript NameFunction/comments
g23.t1hypothetical protein
g24.t1XP_009515389.1 hypothetical protein PHYSODRAFT_309032 [Phytophthora sojae

Sequence
30254 bases(100 bases per row)
TGCCGGTGATGTTGCTTGCGCTCGTGTGCACTTGGTTCACATTGGTGCAAGCCGTACAGGTTCTGTCACGGTCAGGCTGCGCTTGCCAACCCACTCTTCA
GCCTGCTACAAACACGACAGTAGCTTGCTCCCAGACGAGCGCAAGCGCTTCGTTTGAATGTGCAGTGGACCCTTCCGACCCCTGCGCGGATGGAGTGCTG
GGCCGAACGTGGGACCTCTGCAATGGTGGGCCGAGAATGACTCATTTCTCCTTTTACGTGAGCACTAACCGAGTTTCGTTCGCGGTCAGTTGTCGACTTG
TACCTCGTTACAGATCGGAGCTCAGCAACTGCGTCGACTGGATCTCTCGATGTAACTTTGTACGGTGAGGAACACGTTGTGCTGCAGACTGCAGAGCTGT
CGAGTGAAATCCTACAGAAGAGGATTTCAAAGGTTACTCTGGCTTTGGATACCGAAGCTGCAATCAAGACTGTCAAGGTAGGCGACTTTGAAGCACTTGC
TTCGTTGGGACCAGTTTACCAGACTTTTCTGCCCGATGCTCACAGATCCAGGCTGCGGCTAGGATATCGCTGCAGATTTTCGAAGTGCAGACCTCAGTGA
ACGACTTGCCCCCCACGATATTTTCTCCTCCAACACCTGGATCAGTCACGTTCGTGGGCAGTGAAGAGACTACAAGCACTGGTATCGTCTCGCTTTGGTT
CGTACCCGTGACGGAGTACTTGAAGGGTAAAACAACCTATTATGCTGCGATATGATGCTATCACTTTAACTGACGTGGATTGGTTCGGTTGACTTCTAGG
TGCTTATCGTAGTCAGTGTTTGTTTGACCTGGTGGGACGCTGCGGGTACCACGCCGATCTCCAGGAGAGTTCTGACTTACTGTTTCTATCTGAAGAGGGG
AATGAACTAATTGTGGCGGCCAAGTCTGTTGCTGCTCCATCATTTCGGCGTTTGACTGAGGTGAAGCATCCGCCGAAAGTAGCACCACGTTCTATCGAAA
TGCTTCCTACAGTAGCTAGTCGTTCTCGAATCCAGCGGACTACATCACCGAGCTTACGTCTAGGTGTTGCGTTACCACGTGGGGATATTATGATTGTTTT
GCCGAATGAGCCTGTGCTGGTACGCTTGAAGGATGTACTGGAAGACATCAAGCAAGCACGAGGTGCAATTGACAACCTCGATCTTGTGTCGATGGAAGCA
TTATGGAGTGCCAACAGTGCGTTTGAATACGCAAAAATTGATGGCACTTCAGCAATGGAAAATGTGGTGGATGGGAAATCCGTGACGTTTTGGAGATTTC
TGCAAAGTAGTTCATTGGTGAAGGTTTATATACTGCAATCTTTCGTCGGCGAAAGTGACTTTGAAATCAAAGTTGGCGTCAGGGTGGCAGGGAAAGTGAA
TCAATACTCTAAGAAGTTCGTCGTGACCATTGCTGGCGATTTGCAATCTACAAAACCTCCGGAAACCAGCAGCTCACAATTAAAGAGTGGATTGAAAAGC
ATGTACACTGATAACGAAGAGGTTGAAGCCGATGCCGGAGTTCCAGATATCCGCCGATTGACTACTTTTGATCCTGATACGGTTATCGTTAAGTTGCTAC
CTCAAACGGTCGATCTACAAGATGATACGCCGCTTCGTCTTTTGGTCGCAGACCTTCTTCCGAACGTGGTAGAAGCGAGATCAGCTCTTTGCATTACAAG
CTTTACGATTTTTGCTTTAAGCAATGCGATTAGGACGATGGAAGTACCATCAACAGGAACCAAAGATGTGTCCGATGTTCACGACCCAACGGTTGAACAT
TTCTGCAACGAGACTCTGTTGGTCCGACTCGTGTCGGACGTGAAGAGCATTCAGGCACAGGTACAGGTTGACATTTTGAGCTCCAATGATGCTGTTCTTG
TATCGGCCAGTATACCACTTAGTTGGACTGTGATCTCAAAGCTCGATACACCAGTACTGAACCAGATTCTTATCGGAGCGCGAAACGCACTGGTCGGCGA
ATCTATGGAGTTGGCGTTGAATTATTCAAATGTCTTGACTAACACAAGCGTGGTCATCACTATCAAGAATTGTTCTGTTTTGGATATTCAAACTACTGGA
AGTGCGAGATCGACGAACGAAGAATGCGCGGCTCTTTTGAAAGACGTTAGTGATGATGCCACAGGAGCCTACAGTGGAGTGATAATCGCTCAGCGTCAAG
ATGTTGCTTCCACTCTCGCTGTTGATGTCATTGTATCTCAACTTCGGCAAGGTGATGATACCCTTTCTTGGATGATCAGTTCGTCCAGTCTGATATCCTA
CGATCTTCACTTTTGCGAGGTAACGCAAACGAACGGCAGCACACTAGTGGTACGCAAGGGAGAGAAAATCGATATTCTTCCTGCTGAGTTCGCTCAAACA
ATTCTCGGCGTGAGTCTACACAATTCACAGCTCATAACAAGCATCACGTTGGTTATGGATGTCGACTTACTGCCGAATGTTGGCACCTTCGAAATCGATG
GTCATCTTGCTCAGGTGAGTTCGTACAACACTACTGCTTCGTCCATCGTCTTGAACCCCAGTAAATTCACATTTACACCGATGCAATATGGATCCTTTCT
GGTTGATGCGATGCTTGACTGGAAAGATGAGTCCAATGCAGAGTCTGGTTGTGTCTTTGTGCAAAACTTGGTAGTATCGGGGCTACCTTCGCTTTCGCAA
CCTGTGTTTGCAGCTCCATACGCTTTCAGCCGAAGGGTTCTCCAAGGCTCACCTGCCCAGCTAACAATTCCAGTGATAGCTACCAATGATTCTGAGATCG
AGTATCTGACACTAGCTGTTTCGGTGAACACCACAGATGATGCGCTTGTCATCAAGCGTGATGGCATTGAATATCATCCTTCGCTGGACGACCAACGCTA
CTATTTCCTCGTCCAACGCGATGATGATATCGATATAGCGAGGCAGGTTATATTTTCTGTCACTCCAAGTAGTGCCTTCACCGGAACGCTTTGTTTTGCT
GTTGTGGTTTCAGCGATTGGTTTTATGAATAGTGTAATTCCGATCGAAGAGCTTAGCATTGATTTGTCAACTATTCGCGAACTAGAGATTGAGTGGATCT
CCACTGCTGAACCATCGAGCCTAACAGTAATTTCTGGGGAGGCAATTTATCGGAGCCTCCCAACGCAGCTCCAAGGCAATTCTACGCTGTCTTTCTCGTA
TCAACTGTCATCCGGTACGGAATTCACCATGTTCTTTTTCACTCTGATTATCAAGGAATACTACTGACTCATGCTGTGTGGTATCCATAGATTTCTCGAG
TATTAGCACGGACGTCATTTTGAACTCAAGTGAGACTAGACGGGTATGGTCAAGTGAGTCTGCTGCGATTAACCCAAGTGAGTGGAATATTGCTGTGGCA
CCGATAACCCTTGCGTATGCTTCGACTGCCGAGATCATTTTCCGTGGAGTAGTTGCCGTGGAAGATGGGCTGTACTTAAAAACTATCGCTCTTCGAGACT
ATACGCAGGAGAGTACAGTAGGGGTGGTTGAGTATATTCGTGCTACTGGTGGTATGATCTACTTAGAAATCAACACAGCAGAATCCATCCCAGAGCCGGT
TTGGTATCGCGTGTACGTAAAAACACTGAACAGCAACGAATCACCTGCTCTTCGCTTCACTGGTAAGATTCTCATTTCTACCCATTTTATATTCATGCAC
TATTGTTTCACCCCTTAACGTTTTGGTTATATAATTCATGGAAGGTGACGGTCTTCAGTATCTTGGGTGCGAGGCCACAACGACAATGTACCCCTGCGAA
GACAGATCAGGAATCCGAGCCATGAGTCCGAGCCAGTGCAGAACCTTGTGCTCGGCTGTCGAAACTCAGCTTCAGTTTACTTCCGATTCGATTGTTCGCA
GTGCACAAATGATGTCTATCCCGGTCAAAGATGCGTTTACGATTGAACTCTGGGTGTGGTTAGACGACCTTGGTACCAGTGGCGAGCAGCTCTTACTACT
ATTCGGCGCTGTGGAGGGGAATCTGGCTGTTTCTATAAGTACTTATTTGGCAATATCCTATTGTCAAAATGAACTTCGAGTTCCTCACGGAGTCCCACTG
CAAAAATGGTCTCACCTCGCGCTTGTATTCAGTGCAAACGACGAGGTGGCAGTCTTGACTAATGGGGTCAAGGTGGCTGATGGCCGACTAAGCAAGGACA
ACTGTAATATACCAGCGTACGCATATCTGCAACTCGGACGAGGTACGAATGCGCATAGATATTCCTTCGCACTTAGCTGGTTTAACCTAATTGTGCTGCT
GCTGCCCTCCATTTGTTTGTCAGACACAATGGACGTTCGATCAGATGCATCTGTTCTACAAGGGGCAATGGATGAGGTAAAATATGTACACTTCTATTAT
GGACTAGTGCTACCTACTCATCGTGTTGCTTCGTGTACTAGGTTCGCATTTGGAAAGTGGCACGCGACACGTTGGCTGTAAATGCATCGTACCAAAGGAA
CATCGCTGACACTGATTTGATCCTGCGTCTGCCCTTTAATTCTGCTGAGAAGACTAACTGGTTCCCCTCGGGGACAGATGAAAGTGGAAACAGTGTGGAC
TTCATGGTACAGAACGTAAGTGTCATAAATACTCGTCCGATCCTTGCGTTCGGGGTTGCTGGAGATGGGAGTTGCTTCTACAAACTGACTTCAGCAGAGG
TTGACGTATTGCCAGCGAACACCTGTGACAAGGCTTGTGGCGATGGAAGTATGAAAACATGCGGGTCCAGCATCTCGAGCAAACTACATGTTGTGACAAG
TGTGTACGGAAAAGGCCCATTGGGCGTTGGTGGGCTGTCTCCACTTGTGGATTACGATATTTATGTCGAGTTTGTATCTGAAGATGGCGGAGAGTATGAC
ATCACTGGGGCGCTCATTGCGAGCACCTCGAATACTACAGTCCCAGGAAAGGTGGAGTACATCAGTGTCGTAGAACGCTCAGATCAGTCGCTTGAAATCC
GGTGGAGCCCCGTTGACGACAACGGAGGGTCTGTAATCTTAAGTTATTTGGTCTTTATGAATGGAGTCCAGATGGAAGGTACTAGTGATGGAACGACCCT
GTCAGTGACGCTAAGTATTCCAGAGATGCAAACCAGCTATAATGTAACTGTGCAGGCTCGAAATGCGTTTGGATTGGGACCTTACAGCGACTCGCTCTTA
TTGGCAGCTGTGTACAGCGAGCCCTCACCTGAGATACCGCAAAGACCAAACATTTCATTTGTATCCGGAGGAACCGTGGAACTCGTGCTGGATGTCACTA
CAGTTTTAGCTGTTGACAAACTTTTGTCTGTGGTCGTTATCGAGCATCGCGAGATTTCTCTCACATTTTTCACGAAGTCATTTTACCGGCGCAACGGCAC
ATCGGCAACTGTTTATAAGCTCCGCCACAATACTGCCTACGTCTTTCGAATAGCTCTAGCCAGCAAGTCCGGCATCCAAAGTGCGTTTAGTATCCCTATT
TCTGTGAGGACGGGAAATAGAGGAATGCCACGCAAAACTCCAGTGCCTTTGGCTACCAAGGCAACAGGTAGGATACACAAGTTTGCAAATTACATTACCG
TTCTGTTATCCCTCCCCGCTCATATTATCTTGTTCACCGCAGGAGGATCAATTACACTGACGATGGAGGAACCACTGGATACAGGTAATGCTTTGCTACA
AACCACTTCGAGGTATTAAGCACTAACCATAACGTCATAGGTGGTCTTCCGATTGCACGATATAACATCTTCATGCTTCAGGATAATTTGTTTTCGAAGA
TAACAAGTGTCGAAGCATCAAGTACTAACGAGATCACATCAACTACCGTGACGCGCGATGTAGATGACGTCCCACTGCGGGCACTAACCGATTACACCTT
CAAAGTGCTCGCACTTCAAGCGGATGTTGTTTGTGATACATTGACAGAAGAAGGATTGGAGAGTGATGCCGTTACCAAGTCAACGGGCTTTGCCGCGATT
CCAGCTCCACCTCCACGTCCATCCCTGCTGCAACTGGCGGGGTGTACTGCGGTCATTACTGCTACACCCCCAAACGATTATGGCGGTACTCAAGTTACAG
GCATGACTGTTGGAGTCTTTTTGTCAACTGGAGTCTTGTATGCGAGCTTCGCAGTTGCCTTAGATGCAGGAACAATCACTGTTCCAAGTCTGCTCGCAAA
CACGAGCTATTTCGTGAAAGTTTCTTTAAAAACCACTGTGGGTGATTCTGAATTTGGCGAAGCGCAGTCATTTACGACAGGTGAACCAAGCCAACCAGGA
AAATTTGCACGCCTCAAAATCGACAACATTGGTTCAAGCTCGCTGAGTTTAAGCTGGGCAGGACCACTGAACTCTGGAGGAGGTACCGTATCAGGTAAGT
TTACTTCTTTGTTTACACTATGCAGATCACGATAATCACAGCGTTTATCGGTTTGTAGGCTACCTAGTATACCAACGTACTTCTAAGTCTTCTGAGCTGG
TGTACAATGGATCGGATGATTCAAACACGACGTCATATTTGATTCGAGGGCTTCTTGCTGAAACTTTGTACGAATTCGCTGTTGTTGGGATTAACCAGTA
CGGTATAACGAGTAAGGAGGACGAAAATGTGATAAATGCTACGACCAGCACCCCCGAGGTACCTGCTATGCCAACAAACGTCAAGGAGAGCGACGTAGGT
GGAGGATACATGGAGTTGTCATTCTCAGCGCCTTTACTAGCTGGTGGATATCCGGTCAAGTCGCTTACCTATTCAGTGCGTTTACAATCGCTATCTTCCT
GCTTTGATAGCGCATCCGGCTGTTCTACGTGTTCGTACGCAATTGGTTTGAATGGTGGTTTCGCTGCGCTTTCAGCAACAACCCCATGCACGTGGGGGGA
TTGTAATACTGAGCAAACTTGTTGTTTAAGTAACGGAGCTACGTGTGGTATTCTACTGATTGAGGTGATGGAATGTAATTCTGTGGCAGGGGCTGATATA
TGTCGTGTTGAAAGTTTAGTTCACGCTACGATGTATATTGTAGCCTTGGCGGCAATAAACAAACAAGGAGCGAGTTCATATTCGAGCAGTATCACCGTCC
GCACCAGTGATGCCAGGCGACCTGGCACCCCGCAGCTTAACCTTGTGTCTGCTTCAGGAGGATCGATCGCCTTGAGCTGGACACTTCCATTGGTACGTGC
AAGACAGGGTTTGAGAGACCATGTTCGATTTATTGATTATCACGTTGGTTTGTACTGACAATTTGTGAATTGTCCTAGGATACTGGAGGTGTTCCGATTG
TGCGGATTTCGCTTAATGTAGATGGATACGAATTATTCGACACTGAGTCAGCATTGACTTTCACTCATTGTGGAGACCTTCACGCAAGTACTGATTACAC
ATATTCGATTGAGATCGAAAATGCGGCGGGACTTGTCAATCGAGAAACATCTTCCTTCATGACGACAACTGTGACTCCTCCTGGTCGTGTGACTCTGTTC
GAGCCTGTTGTAGGGGTGCAGGTTGCCACAATATCTGCTGCTTTACCATGTGATGATGGCGGTATAAATGCCGATCTTACGCTCTCTTATCGCGTTTTCC
GGGTCAACGAGGTTCCTGCGTTGATTGAAGATACAGCTTCCTGTTGCTCCATCACAATTTCTAGCTTAGAAGCGTCGACTAGCTATCAAGTCGACGTTAG
AGCCAAGAGCTCAACCTTGTCAGGTGACTGGAGCACGATAAGTTTTACTACCCAGAGTGGTATACCCTCAAGCCCAAACATATCGCTGCTACGTGCAACA
TCTACAACGCTAGAGCTGGAGCTTATTCCGCCACCGGTAACTGGTGGTGAATCTCTTTCAATCGAGGTGGAGGCCAGGAACATCGTATCTGGCGATGTAG
TTTTTCAGACCACCTTGTATTGCTCTCTAGCAGATTTGAAATACGACTGTCCTGATACAGTCTCAATTAGCGGACTTGATTCAGCACAAGACGACTACAT
TTACGATGTGGCTGCTCGGGCAGTTGGAACTGGAGGGCCAAGCGATTGGGTGAACCAGTCGTGCAGTTTGGACAATGGAATACCAGAAAAAATTGGCTTT
GTTGAAACCATCTATCATGGCATGGAAGGCAGCGATATTCACGTGAAAGTTGCGCGAGTATATGGTACAACAGCGCAAGACGAAACAAATTTTGAGATAT
TCTCTGGAACGACAGTACTTTCGTGGTCTTGCTCACCAACCACTGCTGGGGCAACTTGCTCTGTTGACGAGCAGGGTAATAGCGCAGGTATATCGATATC
GGAACCATCGCTGTCATTTTCACTGCTATCTTAAACTAATTAAATGTTGTGTCTGCAGGAAAAATCACCTTTGAAGCTGGAGAGTTCTTGAAAATGATCA
CTATTACAGGATTCGATGATGCGCTGTATGAAGCTGTACCGGTGTCGATAAACCTTACTCTTGTGAATTCAACAACTAGCGAGGTCAGCGATACTCAGTG
TGAAGTTTTATTTGATGACAACGGAGATGCTGGAGTCCTGAAGTTCAGCACCTCACATGTGACAGTAGTTGAGGATATGGGATCAATCGATATTGTCCTT
TTACGTACCGGTCGAGTTAGCGGGGTGGTGTCTGTGACGTTGTTATCAACTATAAGCTCGAGCATTAGTGGAAACCAACTTAAAGAGATCGTGAGTTTTG
CAGATGACATGGGTAGTGCAACCGTGTCCGTTGGTATCCGAAGTAGCAAAGAATACGAGTCCAGGCATTTTGTTTTATCGCTGGTGAACGCGACAGGTGG
TGCGGTTTCTGACGGCAATAATTTGACGGTGGTTGTTACGGATAAAGGAGATCTGAGTCTTCCTGGTCGCCCTCGAGTTGCCCAAAAATCCTCCACTGGA
GGATGCATCGAATTGTTTTTCCAGCCACCAACTTTTATGGGCAGAGAAGCTGTGGCATCGCCTCAATACATTGCGAGCATATACAACAATAGCTTTCAAG
CTTCATATACGAGTCCATCGGATACCCTCAACGTTTGTGGTCTGGTCTCTGATTCCACCTACGTTGCTGTTGTTGCGGTCAATAATTCATATAGACCAGG
GGAAAACAGGACGATAAACATTTCAACTGGGGCGCTTTCAGCTCCAAGCGAGGTTGTCGACCTGAACGCTGGCACTATTAGTAGTGGCTATGTCGAGTTA
TTGTGGAAATCGCCTCTCGATAGTGGGGGTAAGTCGATCAGCGCTTACGAAATAACGGTCTTGAATGAAGCTACCAACGAAGAGCGAAGCATTGAGACGG
CTAGTTCTGAGCTCACTGCGTCAATTAGTTTCTTGGCAGCGGCTACAACGTATTTGTTTAGTGTCCACGCTGTAAACAGCGGTGGGCTGGTGGGACGAAG
TTCGAGTGTTAGTGCTTTGACTAGCGATGCAGAGCAACCTCAGCGACCTCCACCCCCTGAACTGATTTACGCTACCGGTGGAGCTTTGCACGTGAGTGTG
ATCGCTCCTGTTGATTGTGGTGGTGCAGACCTAGCAACCTACACTCTTGATATTGCTCGCAACACTGGAGAAGGTTTGACTTATCGTCAGTACAAAACGG
ATGGAATTCAACGCCCCCCTTACGATAGACGTGTCGCCAATGTCTCCATCTATGGCCTTCTATCGAGCTCGGAGTACTTTCTTAGAGTGTCCGTGTCAAA
TACGCAGGTAATGCATAAACTTGTAGCGAGTGGTGCTAATTCAGCTTTAACCCATACTATTCTTCTTCTTTATAGGGGTGGAGCCAGCAGAGTGATGCAA
AAGCATACATTACCTCCGGTCCAACACCAGTTAGCGGAATGGTAGCACCGACTGTACTGGTGGAGGACCCAGGAGAGCTGACGCTACAATGGGAAGCACC
GCTAGACTCCGGGGGTCTTGGTATTGTGGGGTACATGTTGCAGTCACGACGCATGTTCAGTAACGGATCTTGGTCTCTCTCTGAGATCGTGTACAACGGT
CGCTCTTCTACACTACGACAGGCATTGCTCTTGAATATTCTCGCTAACACTGAATACGCTATCAGCGTCACGGCTTACAACTTTCGCACACTGTGTCGAC
CAGACGAGTTCATTACACCAGGTGATGAACTCAATATTACGACCCTTGATACCTCTACACCTTCACAGCCGAAAAACCTTCGCTCGAAATTGGTGACCGG
TGGATCTGTTACTTTAGCGTGGGACCCTCCTCGGTCTTCCGGGGGAGACACGCTACGTTGGTATCTAGTTCGCGGAGGAATGAAGGGCTTTGATCTCCAA
CTAATGGCAAATGTCAGTGCTACAGCATCGAGCTCGATTGCGTTATATGGATTTGCTGCTTTGACGCCTTACGAGTTCGCAGTTGCGGGAGAAAATTCGC
GAGGTTCTGGAACATACTCACATTCGGTGCTTGTGACTACTAGCTCGACGAGTGCCCCTGGCTCTCCAAAAAATCTGCAACAAATAAATGTTCGTTCTGG
CGGCGCAATTCAATTAGCGTGGGACCCGCCTGACGACTCCGGTGGGGCAAACATTCAGTATTATAAGGTGTTACGCAATGGTACTTTAGTTGACGAAGTA
ACAACAGGGAGTTTTCAAGACCAGAAAAATGTAGTAGCGAAAACCCGCTACACTTATACTGTGCTCGCATCGAATGATGTTAGTACGGGTACGGATTCAG
CTTCGATCACTGCCACTAGTGCAGATGCTTCCGAACCCGCTGCTCCATTTGCGATAACAGAGAGCGTTAGCGGAGGGTTCATCGTGTTGAACGTGACACG
TTCTGCTGACTCGGGTGGTATTCCTGTTCGTTACTTCCGGTTTACAGTGCTGCTGGAAAATACACTGGTTGGCAATTTTACCACTTCGAAACCTTACACT
ACGGTGTCAGTAGAAGATCTCACGACGACTGAATTTGATTTCACAGCATCGGTCGATGAAGTCTTTACTTCTATCATCACGGTGGCAGGGCTCTATGCTG
AAACTGAATATTCAATTATTGTTCAAACCGGCAACGATGTGGGTGAAAGCGATTCAGCCACGTTGACCGTCACCACCGGTAGCGCGACAATTCCTGATAT
CATGGTAGCCCCAGGGCTAATTAATGTGACTGGAGGTCGATGGCGATTTAAAGTCATTCCTCCTGTCAATTTTGGAGGTAGCAAGATCTTGGAATATAGA
TTTTTCGCGAACGATTCATCTGCGTACGTTGTACAAGAGTCTAGCCGTGAGTTTGTTCTTGTTAACTTAACATACCTCTCGTGGTATTCCATCACTGTTT
CTGCGATTAACCGTGTCGGAAAAAGTGAATGGAGTGATGCATTAGTCGGGCAAACATCCTCAGCTACGGAACCCGGTGACGTTTGGGATCTTAGGATGGT
CACGAAAACGTACGAAACAATTGAAATTGACTGGATGGCTCCAAATGACACTGGCGGAGATGCAGCCAACGTTTGCTATGAAGTTAAATACTTAAACGCC
AGTGATGAAAGAACGATTGCAAATATTTTGAGTCCATTAAGATTGGTTGATCTTCTACCGGATATGGAATACTCGATTCGAGTACGCGCAACAAACAACA
TTGGAGAAGGCCCGTGGTCTACCAGTGTGGTCGTAAAGACCGACCCACAGTCACCCGGAATAATTAACTTTGAAACAGACGAAGTCACAGTATCGGAAGG
GTACCCCTTCGTTCTTGTAACAGTGGTACGTACCCTGGGTGGATTTATGCCTGCTCAATGTACGTATGAAACGATCAGCGGTACGGCCCTGCCGGGTATC
CACTACACTGAATCTAGCGGCCTAATTGAATTCGACCGCGGAGTGAGTTCCCAGACGATAAGTATCCCTATCATTAACAACGATGTGATCGATGACCCAG
ACAATTATTTTTCTGTTTCGATCCAACAGGGCGGCACTGAATCGGGTGTCATCGGGAACATATCTGAAGTTCGTGTCACTATCACAGACGATGGAGATGC
AGGTGTGGTTGGATTTGAGCTGGCGAACTATTCCGTGTCTGAATCGATGCCAACATTAAGTATAACAATTGTGAGAACATTGGCTTTTAGCGGCGGTGGA
ACTGTTGCTATCGATACGCTCCATCCTCCTGGCGGTGCCGTTGATGGTGTCGATTATACTGTTGATAAAATGATTGTGTTTTCTGACCGACAGAAACAGG
CATCACTAATCGTTAACATTAGAAACGATACGATCTATCAAGAGCAAAAACGATTCCAACTCAAATTGAGTGTACTTGAAGGACGCCTCGCTCTGAGTGA
ATTATTTACGACTTCGATTTATATATATGATGACGGAGATCAGTCGCCACCGGGCGTTCCCACCAGCGTTCACATTGATAAAGTTTCGGGAGGAGTGATT
GGAATTTCGTGGGCAGCACCTGAATACCTTGGAGCAAAAAACCCTGGAGCCATATCTTATACGACACGTGTGGTGGACTTGCAAAGCGGGTTAGTGCGTG
AGCAATCCGTAACAGACGTTAGCCTTCTGATTGCAGAGTTAGCAGCACGAACAGCGTATAACATCTCTATTGCAGCGAAAAACGATTTTTTCCCGGGGGC
ATACTCAGTTCCAGTATCGATCCTTATGGGTGGACCAACAATACCATCCAATCCTGTTAATGTGCAGCTTCTGTCACGAACGGGAGGAATGGCAGCCTTG
TCGTGGTCAGCTCCATTTGATTCAGGTGGTGCTGCTATAGCCAGCTATCGTGTGACAGTGAGCACAAGCAATGGCAAATCGCTTGTGGGTACCTACACTG
TAAATGAGTGTTCCGTATCAATTTACAACCTCTTAGCGCTCAGTAGCTACAGTGTAACTGTAGAAGCTATCAACCAACACGAATTGATCGGGATCGTGAG
TACTGCTATCGAATTGACAACTACGACAGCTTCTACACCTGGAAAGCCTGCTACTTTGAACACGACAAAGATAACAGGTGGAGCACTGCTTGTCGAAATG
ACACCTCCGGCGGATATCGGCGGCGTTCCCATTTTAAATTTTACTCTATTCATGACGTCTGCACAATTCCCGAATGCGTTTCGTCAAGTTTACCGAGGTG
CAGTATCATCGTTTTACGCAACACGCTTAACGTTTTCCACAACCTACAAGCTCCAGTTCAAAGTGACCAACGAAGTGGTACGTCTGACTATGAGATGTTT
GTAACCCATATTTCTTAACACCATTTATACGTTTGCTGTCGCCAGGGTACAAGTGAGTTGAGTGATGTGTTTGTTCAGACCACCAAATTTCTGTCGCTAC
CTGACGAAGTAACAAACCTTGAAGCTCTTTCTCAAACAGGAGGGTCAGTCACACTTTCCTGGACGCCCCCTGTCGATTTTGGAGGAGCTGATGTTACAGC
TTACGACGTTGTCTTTTCCTTTGGGAATTCAATCAAGGCACAAAACCGGCAAAGGGTTTCTGGAATCAGTGTTAACGCGACGTCAGTAACCGCAAAAGTG
GTGGGGCTACTGGCGAATACAAGCTATGGATTTTCTGTGTCTGGGGTCAACGACGTGAGTGTATGTGAAGATCCCACTGCACTTCTCAAGCGAAATATTG
TTTACAGAAGCACCGAATCTCTGGTGTCACTCCCTGATACACCTGGGAACTTGGTAGTAGCTGTCAGTACATCTGGAATGCAGATAATACAATGGTCTCC
TAGCGCAGACACAGGAGGTGACCCCTTTATAGGGTATCTGCTTTACTCTGACACCGGTGATCTCCTGTACAATGGTACAGGTACGACCTTCTCTCGTGGA
TCATTAACGCGAAAAACAGTTTATGGCTATTCGATTTGCGCGTGGAACGGTGCAGGAACAAGTGTATCGAGCAAGCTGGTACTTGCAGCTACTAAAGAAG
ATATAGTTGCTCCGAGTCAACCCCTTCAGTTCATGCAAACTGGTAGCACTGGTGGTTCGATCCGCCTATCGTGGCAGAAGCCTTTAGACAATGGTGGGGA
AACCCCCATATCGATGTACAAATTATATCGTGACTCCCTTTTTAGGGCAGATATCGTATCAAAAAACGCAACCGTGGACTATGTAGACGATCAAAATCTG
CTCGCACAGATGAAATATGTGTATGCCGTTCACGCAACTAACACGGTTGGAATGGGAGCGATGAGTGAAAAAGTTGTAGCTACTACAACTATTGCAACTG
TACCTAGCCCCCCTAATCAACTTGATGTTGTTGCAAAAGGTGGAAATCTTACGGTAACATGGTCCCCTGATGCAAACACAGGTGGTATTGATCTGACATT
CTTCAATCTGGAGGTGCTAGTTGATTCGAGTGTTGTATTCAGTAAATCTTTGGAGAAGACTCGGTCATCTTACATCATTTTCGGTACCAGAGCTGACACT
TGCTATACTGTTCGTGTGATGTCTAAAAACGACGTTGGCGAAAGCATACCGGCTACTCAAACAGTGACAAACGGCGCAACAGTTAGCCCGGCAGCGCCAA
GAGCTCCTGAGCAAGACACCACATCTGCTTTGTCAGCATGGATGATAGCGCTGAAGCTATATCTGCCAATTGATGACGGCGGAGCGCCAATTTCCCGTTT
AGTTGTGTATCGGAATGGAACAAAATATGACGCCACTGATATAAGTCCTACGGATCAAACGGCACTGGGGGATGGAACAAGCCGCTCCATATTAATCGAG
CTAGGGCCTTTGCGTGCTGGCACGGTGTACGCTTTCGTTGTCTCGGCCGTTTCTTCCATAGCGACAATTGCTGAAGGTGCTCGTAGCGATGTGTTGGAAG
TATTGACACCTCCTGCAACGCTTCCCTCGGAACCCCTCACTGTTAATGTCGCATTGCGTACAGCGTTTTCGGTTTTCTTGGAGTGGGGTGCATCTACGGA
TACAGGAGGGGATGATGTCGTCTACGATGTTTCCTATGACAACCTGAACACAACAGAATCGAGTACAACTCAGGCAAACATCACCGCTATAGAGATATCC
AAGCTAATGCCAGGAAACATATATGCAATCCGTGTGCGTGCTCGAAATTCCGCGGGAACAAGTATCTGGACACCAGACGTATATACTGAAACGGATATAA
CTCAACGCGGCGTCGTCACTTTTAATTTGGCTTCTTCAACTGTGTTTGAAAATGTCACGAGTGTTATAGTCGATTTGCTTCGAGTAAATGGTTCTTCGAG
TACGATCACATGCAGCATTTCGGTGGGTGGAGGGACAGCTGTTAAGGATCTGGACTATACTCTACCGTTCGAGTCGGAGCGTTCTTTTACATTTGTGGGA
GATCTCATAAAGCAAAGTTTTGTGGTGACTGTAATCAACGATGAAATTTACCAGTCAGCCCCACGGACAATCATTTTTTTCCTCCAGGACACAACTATCG
ATCGAAGCGATCCATTCCCACTGACAACTATCACACTCACCATTTTGGATGACGGAGATGCTGGAACGATCGGGTTTGCAAAAAACGAAGCCGTTGTCAT
TGAGAATGCTCGAGTATTAGCGCTTCCTCTGCAACGCCTCAATGGAAAGAGTACAGCAACTAGTGTGCGGGTTGTTGCATTTGGTGGTCTCCCAAGCACA
ACGCAACCTGAAATCGGGTTTCGTTTACCTATCGACTCCGTCAACTTTATCGACAATCAGGTTTTCGAAACGGTAAGTATTGTGATTAAGGATAACGATG
CATATGACTTTCCATATCTGTACTTCTATCTGTCCTTGGAAATAACAGCCGGAGCAGCTCAAATTGGAACGAATAGTGTGATTCGAGTTGTAGTGATCGA
TGACGGCGATCGCTCTGCGCCTGGGAAACTTGAATCACCTATGCTTGATAAAGCAACGGGAGGAATGCTGCTACTAAAGTGGGAAGCTCCTGTCAACGTC
GGTGCCCAAGATCTCTGGATCATAGGCTACAACATTTCTATTCGTACTGCCAGTACTAAGAAGTGGATAGTAACGCCGTCGAATGCGACTTCGCTACCCT
TTGGAGGATTGAGTGCCCTGACCAGCTACACTATAAACATTTCAGCCATTAATGCGATTGGGCGTGGTCCAAGTAGCCCCAACGTCACTTTCCAGACTAT
CGATCTTACATCTCCGGGAACAGTCTCACAGATTGCGTTAGTCAATCGAACGGGTGGGCTGCTTACGGTCAATGTATCCGCTCCCCTGGATACAGGAGGG
GCCCCTATAACAGGATACATTTTGTACTTTGCTGACCAGAATGAAAATACTAAGGTTAGTACTCAAACCCGATGGTGCCACATTACCCGTCGAAAAAAGC
TCACTGTGATGCTTGTTTACCCAGGTGGCCTACAATGGCACAGGACTACCTTCATCGCTGATCCGTGTCAGTGTTACCAAGGCAAATACGGTTTATAATC
TCCAAGCAAAGGTGTGTAGGTTTTATTTTCAACGACTTGACTAGTTAAGATTGACGATACTTCTACGTTATCACAGGCTATTAACTCTGTCGGTCCGGGA
GATTTGTCCCAGTCATTCGCATTCCTAAGTGGACCCCTATCACGTCCAGGACCGCCTCGACTCCCCACGGTTCCTTTTTCGCGAACGGGTGGAGCAATAG
CGTTAGTTCTAAAGCCTCCAGTTGACACAGGTACGTATTTATTACCCGTTGTTCCTATGATCCAAAGGAGAGTCCTACTGAGACACCTACATGCAGGTGG
TTACGAAGACATATCATACACGATATATTACCGGGAACAAGGAACGGGAAAGAGATTTCGTCAGGCATATTGCAACACGCAAGGCTTAGACATCACAGTT
TTTCGTTTGGCAGCGGATACTGTCTATGACATGGTTGGAGTTTCAATTCTCAAAGAAGATGTCAACGCACTTGCTGAAGGAAATATTTCTCTTTCCGATT
CAAGTATTGTTCTTTTCGAGAAGAATTCAAGTATCCTGACTAAAACCGGGTACTTCGATTTCGGAGTAAGTGCTTTTAAGCCTTCTTTATGATTTCCATG
CTAACCATCTTATCGTGCATTTAACGAATACAGGGATATATCTTCGAGGTTGACTCATCACAAACTCAATCGAGCACGGCCATAGTATACTTGCCATCGC
TTAGTGCAGGTGACGGATCCATAGCTATCATGGACTTGATGAACTTCGATGTGTACGACATTTTTGTGCGTGGTGCATACAGTGACGTCGCAAACTTCAC
TACGCTGGCTCCAACAAGACCAGGGGTCCCACCACAACCTGTACTGGATTATTCGACAGGCGGGGCACTTAATATACGCATTTCCTGGCCGAACGACACT
GGTAAGTTGCACGATAGCGTATTCTGTCTTGAGCGAGATTAACCCATGCTGTAACGGGATACAGGTGGGGTTCCCATAACGAGCTACGAGTTTTACATTG
ACGACAACACGGTGGGAATGTAAAAATGCAATTATCGGGAAACTAATGATTAACGCCATCACATATACTTTAGGTGGACGGGACACTGTACAGTTACTTA
CCACAAGATGACTTTGCCCTCGAAGTCACAGTGCAAATTGGGGGTCTAGCGCCTGAAACAACCTACAACTTCTACTATATTCCGATAAATGATGCGTCAG
CATGTCCTGGCATGGATGACGATATTCCTAAAAGGGCTACGTTTGAGACGGACGTAGCCTCCCTTTCAGACCCAGTTCAACTGATACGAGCTTCTGGAGC
AACCGGAGGTGGAATCCACGTCGAAATGAAAGCTCCGAACGACAGGGGTAGCGATAGTGATCTATATTATCAAGTGTACATGAGCCCAAGCAGACCAACA
CCAGTTTGGACTCTTGTTTATAACGGCACGGATAACGCGTATTGGCAGACTAAGCTAGAGAAGGTGACTGAGTATTTGTTCAAGGCTACGTGTATGAACG
AAGTCGGGTACTCCAATTCCTCGGCGGTCTATCCACTCCGAACAACGCTGGTGTCTTCTCCAGGGCCCCCAAGCGGTTTGAATTCAACAAATGTAACAGG
GGGTATGATTCATCTTACTTGGAATAGTCCAGATGACGACGGCGGTAGTGCAATCACTTCCTACTCAGTGTACGCGAAAGATACGAGTGGTGAGGTGGAT
TTGGTAAAAGATGTGGAAACGACCGACGTTTCTTTTGGGGGATTGCTTGCAAAACGGAAGTACGAGTTTAAAGTGTATGCGGTAAATAATTTAGGAACAG
GATCGGATCCTGAAGTGGGAAGCTTCTCAACTGTGGCCGCTACACTGCCATCAGTACCCGGAGAACCGGTTGTTATCAAGTCGTCCGGAGGTGCAGTAAC
TTTAAAAGTGCGTGTACCGGATGATACAGGTGGCATCAAGATTGCCGATTTATCGTGTATTGTGTACGCGAATGGTGTGAAACTACCAGCAGACTCAGTA
TTACTACTGTCCACTGTATCTATGGGAGCTCGCCGTTTGATATCAAGGCAGCTTGCGACGGATGGAGAATCTGTTATCTATGTTTTAGCTGGAGGATTAT
TCCCCTCGGTGACTTACTCATTTACCGTTCAAGTGACTAACGGCGTGGGGGCAAGTGACATCACCAACGGCATCGATGGCACAACATCAGTGGTTTCCGT
TCCCGGTGCACCTGTGCCGCCAACGGTAGTAACAATTACTGGTGGTGCTCTAGAGCTGGCGTGGACAGACCCAGTGGACACTGGTGGAGCTCCCATATTA
TCATACAGACTCCGTATGACGAGATCAGATGAGGAAGTAGGAAGCTGCGAAGGGATGATTCTATCGTGCACCATTGGAAATTTGATGTCTGTAACAGATT
ACGGAGTAACTCTGATTGCTTACAACCCTATCGGAGAGTCTCCGCCCAGTACCCTTGTTACGTTCACAACTGGAAAAATTTCAAACCCCCAAGAGCCTCT
GAACCCCCGTATAGCGAGTGTGTCCAACGAGTTGGTAGTCATCGAATGGAATGCGTGCATAGACTTCGGCGGGGCTAATGTTGACACCTATCGCGTGGAC
GTGGTAGAAGTAACAACTAATTCGATGCTCTCAGGTAGCGTTCCATTGGCGCAACAGAATATCACTATCACCGGCCTGACTCCAAGAACAGATTATGTTG
CTACTGTGGTAAGTTTGGTTCATCGTTCATTCATGGTCAGTGAAGCAAACTTACAGATTATATTGTATTCAACAGCGAGTAATTGGGGATGGTCTGCAAG
GGAAAGCGAGCAAGATCATCTACTTCAAAACGCCGCAATCGTCCAACCAGCCTCGGCCACCTGCAGTTGGATGTCGTAAGCGCTTTCTGTAATTTCAGAT
GTGTCAACCTTTCTTGTTGCTAACGATACGCGTTTGCGTTATGTGTAGATTCACGAACAGTGGCAATCATTTTTTGGGAGGCTGAGGACGATGCGAACAG
CTACTTTCTGTATCGGAATGGAAAAATGCTAAGTGACAATGGAGACGACATCACGTTTGAAGATACTATTGAAGTTGGTACTACGTATGCCTACAAAATT
CAAGTAAAAAAGCTGGACGGAACGCTAAGTGACTTCAGCGAAGCAACTCAATTTGTTGCAACAGCTCCGATCTCCAGCGGCTTTGATTGTTTTGGTCGCA
AAGGCCATATTCATTGGCACGATTACCACAATTCCGATCACGAGACGTGGACTATTAGTCCAGAAGACCAAGCCGGGCTCTTGATAAATGTAGGTTTCTT
GTCTTGCTCGACATCTAACTGCGTGGGTACTAATCTGTTTACTGGTAACCGCTACCATGGCTAGATCACAATGTTTTCTCTCGAGTGCAATCACGATAGC
TTAGCCGTCAGTGTAAAAACGAGCGGAACGACTACCCAGCTATGGAAAGGCGGGTGCCAGCGGGAAGGAAGCTTTATTATATCAACAGCAGCTAACATCG
ATAGCGTCACACTTTCGTTTACATCAGATGGGAGTATAACCTACGAAGGGATGGCACTATACTACGAATCAGTGGATTCTTCAGACGCCGTACAAGCTGT
AACGGTGCCATGTCCAGTCTCGTCGAGTGGTCTATGCTCACTAAATGGTGCTTGCCGAAGCGGTTTTTGCTCCTGTTTTAGCGGCTTTGTTGGGGAAAGC
TGCAGCAATGCTGTCATTTGTCCAGATGATACCACGACGTGTACTTCTTCGACGTGCGATCCAGTTTGTCTTCAGTCTCAAAACGATGTGATTGTGGTAA
GTGTAAATGGAGATGATATCCAGGGAACCGGTCAGCGTATGGACACTTCTCAAAGTGGAACAGATCCGAAAGCTGTAAAATCTCTCCGACGAGCTCTAGA
GCTGGTGCAGTCCAGCCAGACAATACTAATTTATCCTGGTGCGTACGACGGACCTGATAACTGCGGTGTGACAGTGTCAATATCGAATATTATTATTCGC
GGGCTGAGGGGCGCTGCAGCCACTGTCATTGATTGTAAAACCTTACACCGTGGCCTAATTATTGACGGCGCCACGGTTCGGATAGTTGGATTCACACTAG
AAAACGCTATTACTAGTGCTGATGGTGGATCAATTAGTGTATCTGGCGCAAAAGTACAAATTGAGGACACATACATCATCAACGGAATTTCGCAGCAGTC
TGGAGGTGCAATTTATGCCTATGACTCAGATATTACCCTCATTGCTACTCAAATTAAAAACAGCTCCGCTGCTATGAATGGAGGAGCTATTTTTCTGGAT
AGCTCAAGTCTCGTTCTCGATCATTCCGTCATTCAGTTTTCAACAGCAAGTCAAGGCGGAGGCATATTCGCTCAAAATACCGCCAGTGTACGTGGTGACT
CTACAAGCAAGCTTTGGGGGAATTTGGCTACTGTAAATGGTGGTGGTATATGTTCCAGTGGGGAATTCGATGCGCAGACATTAACCATCGTGCAAAATTC
TGCTCTAGTTGGTGCAGGGATGGCAGCAATTAATGGAAAAGCAACGCTCTTGAATGTAGAAATAACTAACAACAGAGCAACCAACGACGGAGGGGGGATC
GCACTACAAAATACTGCAGCTGTGTTTTTGAAATCCTCCCCAGTCCGCTTGAATCATGCCGACCGCAATGGTGGCGGAGTTTACGTGGGGTCTAACGGTA
CATTTGAAAGCAGCTTAGGGTCGGAGATCTCCAAGTGCACAGCAGGTAAGTTGATGCTTTAACATTTCCACACCACATGTATTGGATACTAACATCTAGT
TGGCGAATACTTGCTCGTATAGCTTCTGGAGGAGGGTTGTATGTCGATGATTGGACTCGTCCAACCATCAACGGTATCGCTGTACTCGCTTCGTCAGCTA
CACTGTCTGGGGGTTGTGCTGCGTTTTCACGAACGTCGGCAGCTTTGAACATTGCAGTTCTCAAGGGATGCAATGCACCTACAGGAGGTGGAGTCTATGT
CAGAGCTGGAAGTAAACTCACGATATCAGGTGCTTTAATCAGTGAAAACACAGCAAATATCGGAGCTGGAATGTACATCGATTCTAGCACAGTCGTAGGA
GTAAATGGTGGGCCATCATCAGTGGTTCGTGACAACCAAGCTCTCATTGCAGGAGGGGGTGTTTTTCTTAGTGGAACACAGAGTTCTTTCCAGTTGTTTG
ACGTACTGAACTGCTCGGCACCTCAAGGAGGAGGCATTTCCGCACACAACGCGCTACTATTGACGATAACGTCGATCCACATCTTTAAAAGCAAGGCAAC
CATTGGTGGCGGTGGGTTATATACTAACGCGTCGACGATCACAGTAACAGATACGAAAGTGACCGAAAATGTCGCGGTGGTTGGTGGTGGAGTGTTCGCT
GTCGACTCAACCCTTTCTGGTAGCATATCCATTAGTGACAATGTGGGAGATCGAGGTGGTGGAGTGGCTACTTCGGGTTCCACGATGCTGGAGGGAGCTT
CTATCTATTCAAACACAGCATTGCAGAAAGGAGGAGGCTTATCAGTGGAGACGGGCATCTTATCATTGAAATCTACTGCGATCAAGTCGTGTTCTTCTCC
GTCTGGTGTTGGCGGGGGTGTATCAATTTCAAGCGCTGAAGTCAGGCATTATGCATTGACCGTTCAAAATTGTTCATCGCTTCGTGGTGGAGGAATTTAT
GCTAATGCCTCCTCGTTCCACCAGTCTCCACGTACAGAGAGTACTGGTATCACTCTGTATGTAGCAGCAATTTCCCAAAATCTTGCAGCCGAGTATGGCG
GAGGTATCTTTATTGACGGAGAAGGAACGATTATCAGCGATGCGATAATAACTAGCGGCAGTGCACCTCTCGGTGGCGGGCTCGCAGCTCTTAAGGCTAA
AGGATGTGTCGCACTAAATGTTGGCATCTCTTCTTCAACTGCCACGAAATCGGGAGGAGGCCTTTTTTTCGGTTCTGGTGCGAATTGTGTATTCCGAGAT
TCCTGGGTGACAGAAAACCAGGCGGTAGAATCTGGGGGTGGGTTGATGGTTCAGGATGCTACATTGTATCACTCTAATGTGGAAATCGCCAGCAATGTAG
CCCCAAGCGCTGGTGGAGTTTACATAAAGAGTGATTTGCTACCGGCTACTTTCTTGTGGTGGAATGATACTGCGACTAAAATTTCCCGTATCCGCGCGAA
TGCCATCAGTCCTCAAGGGGGGAATGGAGCGAATGTGCTGCTTAATTGTACAGACACGTGTATTCTATCGGGTACTCAAATCTCGGATGGAAACTTGCAG
GTCGGACAAGGAGCGGGGATGTTTGTAAGCGGTAATGGCCATACATCGATTTCAGACTCCTTGATTGCAAACAACTCCGCTGTACAAGGTGGCGGAATCA
CAATAAGCGGCGGAAACATAACGGCATTCAAAAATGTAGCTGTGGTGGGAAATGTAGCAAGTGATGGTGGCGGTGGATTGTTCGCGGAAAGCTTGCAGCT
ATATCCACCGGAGATTGATCTTGTCAACTGTGTATTTTACAACAACTCAGCAAATAACTACGGTGGGGGGATCCTACTTCGTGCGGTATACTTGTATAGT
TCATACCTGTTGGTAGTCGAGAATCGTGCGGTGAATCGTGACATTGGCAGCGGTGGTGGTCTCTACGCTGAGAAACTAGCGAGTATCATGGCCGACAATT
GGTTGTTCTTATCGAATGACGCAACAATTGGTGGCGCGATTACTGGAGTGACCGGTTCCGAGGTCAGTCTCCTCGTCGCCTACGTCACTCGTGACTCAAA
AACATTTTTTACGGAGACGTGGAAAGATCTTTTCCGCAATCTTGTGGGTTTCGAGTATGTAGAAGAGAGGGCTAAATACGATGTGGCCGTGCAGAGAGGT
GGCCTGATCTACCTCTCCGATAAAGAATCCGTTTTGGAGCTCTTGTCATCTTACGCGACGCACGGATCAGCAGACGCTGGAGGGGGGCTCTATATCAACA
CTAATGCTTTTTTTTACAGTGAAGAGTCCGAGATCAGCTACAACAGTGCTAACGAGCGTGGGGGGAGTTTGTGTGTATCAAATGGTGCTCAAGCTTACTT
CGTCAACGTTCAGGTGATACGCAGTGGTAAGTTATGTGTCGTTCGTAGAGCTGATGTGGAGAAGCAAGCGAAACTAACTGGTGCACATTTGTTTTTGCTG
CACCACCAGAGTCCAAAACCTCTGGGGGCGGGATCTTTGTAGAAACATCGGGTAAAGTTTATGTGGAGAGCTCCAACGTATCGAACAACTTTGCTGATGA
CTCTGGCGGGGGTATTTTCCTGGACACGGGAGAGAAAAACGCTGTAACTCTGAACGATTCCTTAGTGGAACAAAACATTGCGAATGGCGAAGGATGTGGT
GTCTTTGTTGGGCGAGAAGCTATCCTTTCTGGCTACAAGTCTCAATTTGTGGGGAATGGTGGGATGACGTCCAGCGGAAAAAGTGAAGGTGGAGGTGCAA
TATCTTCTGTTGATGGTGTTGTGAAGCTCACAAGTTGTACTCTTGCAAACAACACTGCACAAGTTGGAGGGGCAATTCATGTTGACCGCAGCGGTACAGC
AACGATCACTGATTCGCATTTCGTGGGTAACACTGCCGATCAAAGTGGCGGGGCAATTGCGACAAATATAAATGCAAAAGTCACCATCGCTCTGAAGACT
TCATTTGAACGCAACAGGGCAGATGTTGGTGGGGCCGTTGCAGCGACAGACAACTCTACTGTCTCGCTATCATCGGTAATACTCCAGAATAACCAGGCCA
ATGGACAAGGTGGCGCCCTATACGTTACCGATCAAGCGGAGCTTACGTTGAAAATGGGAAAACTGATTAGCAATACTGCCGTTTCAGGCGGCGCTCTCTA
TGGTGATAGTCTGTCTATCGTTGGCATCTCGGACTCCCAGTTTATCTCTAACACAGCATTTTCTCGTGGGGGTGCACTCTACTACCAATCCATTAAAACA
ACTACGACTACAAGAATTTCTTGCACCAGAAACACTGCCCCAAGCGGTGGGTGCATCTTCTGGGAATCCTATGATGAAGATCTGAAGGTGCAGCACCCAT
GTACATCTTGCACCATGGAGTCAAACGCAGTATACGATATTGCAACAAATACGAGAAATGTTAAAGTGTTGTGGTGGCCTGCGAACATAACAAGTGGCGT
AAAAATGCTTGAACCACCGGATGAGGAATCGATTGAAGCAATTGAAACACGGAATGAAACCTTGGAGGCCACTACGTATGTATGGCCTCGACTTCAGGCT
GTCGACTTGTACGGGCAAATTGAAGTGCTGGACAATCGAACCGAGTGTGTTGTGAGTGATGGCCTGTGTAGCGAGCAAACTGAGCGGGTGTTGTTTGAGC
CCCGCACTCCTGTTCGTGCAGCAATTGGAGTGATTTCCTATCGCGAATCGTCTTTCACTGCAGCTAACCGAACCCCTGAAGATGGAATTTACACTACACA
CGTGTCGTGTGATCTGCCGGAGTCAGAAGTTCGGTCTTTCGACATGGACGTAGCGTTGTTACCATGTCAGCCGGGGTTTTCAGTCAACGAAGGGTGAGAT
CAAAGACTTAACTTGCCGAGGCGGACTGAGTTGCTGCGATTAATATCTTCGTGCTTTTGCTTGAACACCCAGGGTTTGTGAGCGCTGCCCAAGAGACATG
TACAGGTAACTGCTGATTGCTACTAGGGCAGTGAAGATTTATTGTGTCTTTTAACCGTGGTATTTGTGTTGGTACTGTCTGGAAGTTTGGATGGTATGAA
GTGCTTTGACTGTCCGTCCGGAGCTAAATGCAACATGACCGTTCGACGTGCTACGGAGACAATTGCGCAAGAACTGGGCACCATTTCGCCACGCACTCAG
GAAGGATTTTATTTGTTTTCTGCTCCAGCGTCAAAAGAAGAGTCGAGTTGCTTCAAACCTTCTCAGTGGAAGAATGATGATCCATGCAAGAAGGTTGCCC
TGGAAACCCCGACAAAAAGTTTATCGGATGTGATCTACGAGTGCTCAAACTACAATGACTTCAACGTGTACTGGGATTCTGAGCGACTTTTTTCCTGTCT
TTCGGGAAAAGCTTTCTACACTTGCGATGTAATGCTGTGATACTCAATATTTGATCTAGGTATCTACTAACTGGATTGTGATTTCGGGTAATTGCGTGTA
GGTTGAGGGGGCCTGCCAGGCCGATATTTCGATCCAGACGATCAATCTAGCCTCGGAAATGGCTTCGACAGTGAGCAATGTGTCATGTGCTAGCGGATAC
GATCTGACAATCTGCTCAGTATGTGCCACCGGGTTCAAGCGAGCCACGGACAACTCCTGCCTGCGTAAGCAGAGCTTTGAATCGTTCACCTCGTTCGAGC
AATCATAAATTCTTACTGGTATTATTTTGTTATGTAGCATGTGATCAAGCCAACGCTAAGGTTCGAGCTTCAATTCGATGGCAGAACTTTGTCATACCAG
TGCTATTGATTCTCGCACTTGTTGGTGGAATTTATGGAGTCCGAATTTATCTGCGAGACCTTACGGAAATTGGTTTACTAGCAAAAGCTGAGGCTGATAG
ACGGCTTAAGCTTCCAAACTCTAAAAAGGGTGAGACAATTATTTTACGTGCTGGTAGGAACTATCGGAGACAATCAATGGTAGTGGTGGGGCGAGTGGAT
CGTGTGAAAAACAAACTCAAAGCCCTTTTCAAGAACTACCAACATCGAAACGCAAAAATGTTGTTTGGCGTTGATGTGAGTCCACCACCAAGAACGTTCC
CAGTTAGCCCAAGCAAGTTCAAGATTTTCATCGGGTTCTTCCAGATTTTCGGCAACTTTCAAAGCTCCTTCGTCGTGAAGTGGTCGTCTGGCATTCAAAA
TGTCATGGATTTCTCACAGAAGTTCAATCTGGTACGTTTGGAACTGGTTCGAGTTGAAGTGCTTGCTGAACTAACTGAAATACTTCAATTAGGACCTGGT
TGCTATCGCCGGTATCGACTGCGTGGTCACAAAAAACTTTTACTTCGACTTCACGTGAGTGTTTGTTGTTGCTTTATCGTGCTCTTGTTTCATTTTTCTG
ACTTGATCATGTGCTTGTCTGGCTGATTTTGGGCTAGTGTCACTGTGACCCTCGTTGTGTTTGCCCTCATGATTATTACCGCGTACTTCTACGCTGGTAT
GCGCAGCTATCGTGCAAAACTACAACTTATTCCGCGCAATTGTTTGCGATGTGGACTCCCGGTGCTTGAAAGTGAAACTATTCGAAATGACGACGAAAGT
TTTAACCCATTTCTGCTACTAAGAAGCTGGTGGCAGACCCATAACTTCTACAAGAATGACTCGCTGGCGCCAAATGTGGTGGAGGCAACAGAAGTTCCCC
AAAACGAAAGCTCTGTCGCGGTGTCAACTCTTAAAGAGACTCGGTCACTGAAGCGCAAGTTCGGGATGTCTCAAGTGCGAACCCCCTACCTAGGCTTGTT
CCGCTCAACTCATTCCAGGTGTCCTGTGAAAAGCCATGTCCTCTCTGGTGCGATTCTTGATCGTACAGTTCGTAGTAATCTACGGGTGTGGCAAGCGCGA
GTCAAGTTGCGTATGAACTATCTGACGTACCGTAACAAGTGCCTGAAACTCTACTGCTGGATGGCTCTCTTCCTGTATCCGTCGGTGTCCAAGACAATAT
TGACCGTCTACAATTGCCAAGAGGTTGGAGACGTCTTTTATCTGGTGGCAGATCGTCGCCTCGTGTGCTACCATGGGCAATGGGCTCTGTTTGGCGTGAT
CGCGACAATCGGTGTTGTGGTGTGGGTCGTCGGAATTCCATTCTTCTTCGGTGTACTCATCTGGTTAGCACAGGATCGTGGTGTAGCTGCACGTCTGAAG
TTGCTGCGCAAACCACACATGCGCGCTCAACTGCACAAGTGGCTCAAAGAAGTGGAGGAGCAGCAAGTCGCAGATGGGCGCTTTGTTCGCCACATGGATA
GTCTTGAAGTGCAGGACGAGGAGCTGGCAAAGTACATGAAGTGCAAAAATTTGACGGTACGGAGGCTCATGTCCTTGCATATGAACTAGAGTGAATACTT
GCTTACCCCCGCGTTTGTATACAGGACTCCACTGTGCAAGCGCGACTCGGATTTATTTACGCTGAATGTAAGTGATGTTGCAGAAATTGCTGCCTTAGAC
TTGCTCTTGACAGTTGTACCTGCAGATTCAAACGATTACTGGTGGTTCGAAGTTGTGGACCTTTCCCGAAAACTTTTCTTGAGTGGGGTAATTATATTCG
TGGAAAATGGAAGTGTCGAGCAAGTGCTACTTGCGCTTTGTGTTTGGTAAGACTTAGTTGGTGCATTTTGTCATGGAATCTTTGGTCATAATTTTCTAAC
GAGCAAATGCTTGGTGTATTTGTGTGTCGTGCCCAGTCTGATGACGATGTGGTTCCTGCTATATTTCCAGCCCTATGACGGATATTCGGACAACCTCATC
GCAAGCATCACTCAGTTACAGCTCTTTTTCACGTTGTGGCTTGGTGTCATGATCCGACTGAACGGTCTCAATACTGAGTCACTGATCAACGTTCAGCTAT
TGAGTTTTGTGCTAGTCGGCACGTGCATCGCTGTTACAATCTTTGGACTGAGTATGATTGTGGCTGAAGGCCTCTCGGAGTCACAGCGGATATTCACGGA
AACGAAGGCGCAGCGTAAGAAACAAGTTCAAGATGAAGTGAGGAAATGTTGGTTCAAGGCGTACAATTACGCAGCTTACGAAGCTCAAATGGTGCGATAT
GGAGGGCAGCTGAGCCTTAGTAAGTTCAGTGTACCTGCTATGCTTGAAGTCTTCCGCAGAGCGAAGCTGGCAGGTGAAGATCCTGAGTATGCCGGCGTGA
TGCCCAAAATGGAAGAAGAAAGCATTGAGCGCTCACCAATCGGTAAACGTCAGCCAGAGTACGTGCTTGAAAACAATGCAGACGATGCAAACCAACACGG
GGATGCCAAAGAGGAGGACTTGCCAAAGAATGACTGCCAGGCACAACACGCAGACCATTCAGCTGGACCAGACCGAATCGAGGGCGTCGACGTAGAGAAC
AAGCTGCCGACACATCGTGCGTCTGATTATGTTAACGACAACGATGTAGCAACTATTCCTCAAGAACCAAACGAAACGAGGTAGATGGGGTTAGGAATGT
AAACGTTTGTCAACTGTTGGAGCGTCATCTTGACGAAGAGGATGCTGTTGCTGGTAGCTTTGAGCCTTTGGCGGAGGACGATGTTGACGAAAATTCTGCT
TCAAATTCGGGTGTTGCTCGACCACAGCGAGGACACGAGCAATCCGTAAGAAGTTATGCGTGCGATCAAAACAGATATAAACGGCGAATATATGTGCATG
TTTATATTGCTTCGAGTCTCGGCGAAGTGGTGGTCACTTGAAAACTTTCGGAGCAAAAAGCTGGACCCACCAGCATTTAGCTGCGTTGGCCTAAAGTCAT
ATCCATTGAGACCGCTAATTCAGCGACGTGAGTTGGGCTGACTAGATGATGGTCCGCCGCCCATGCCGTAGTTGCAGATCTGGCACTCCTGTGTCCTCCA
GTGGTAGGCCCCATTGACGACATCAAATCCTACAGCAAATTCAGCACAGTATCGATCGTATAGAGCTTCCCACTCGCCAAATGTTACGATCTCATACTGG
CGGGCGGGAGTCGTGCCGAGACTACACATACCAAAACCAAACAGTCAAATCAGGCGCATGATTCTCAACTACGAGCTAGCAAAGACACACAACCAAAGTA
CGTACGCTTGCGTAGCCTTGAGTGATTGTTCCAGCGAGAACCCCGACAAGAACATAGAGATGTAGGGCGGCACAATCGTCCTCTGATGCGACAAGCACAC
CAACTCCGCGTTCAACACCGGCCCGGGGGCATCATCCCCTTGACTTCGAACATATTTGCGCCACTTGTTTAGCCACTTCTTGGGCACCAAAAAGTACGTC
GCGTATTTGCTGCGTCCGTTGACCGACAAATGGGGCGCCAACTGCTGCTGTCTGCCCACCGAGTCCTGCGGCGAGAACAGTCCCTTGGGGAAGCCGTTCT
TCCTCTCCAGAAGCTGTAGCATGGCCTCCGAGCCTGCAATCTGTCCGTCAAACCTGGCCCTCTTCCTTTCCTCGGCCTCCAGCTCGCGCGCCTCCTGCTC
CAACACACACGTTATGCAGTCGCAACACGACCGCAGCGGAAACCCCCTCAGCTCCGGCGCATAGATAGCAATTTCCCTGAACACATCCCCGCTGATAATG
GAGCGTCGACTGCGCCCCACACACTGCGCCGCCGGCAGCAGGGCGTCATGGGCGCAGACAATCATGGCTCCTGCCTCGTCGAGCGACGAATTAGCTGCAA
TTTTGAGCTTCTCCGGCTCGGAATTGTCCTTCTTTTTAGCAGCATTTTGCCGCCGCTGCTGTCGTTTTGTGTGGCGGAACTGCAGCAAAAACTGCTCGAA
GGCCTGGCAGCGCTTCTTGTAGGCGCCGAGCCATGCTCGGCTCACGACAACGCAGCTTGGCGCGCACAGCGCCGCGTCCTCGAAAGACCGCGTGGACGAG
CGCGCCAGTAGCTCCTTGATACGCAGCAGCTCAGCGCCGCGCAGCACTGTGAGACTGCGGGGCCAGTGGTCCACGGAGGCCCGCAGGAAGTCCGTAACGT
CGCCGAACTGCCGCGTGATGACGCGCTCTAAGGCCAGTTGCACGCACGCAGATGAGGCGGACAGAGAGCGACAGGTAGACGTGAGTTGGAGCACATCGCG
CGACGATAGCAGCGAGAAGAGGTGCGCTAGAAGACCCTCCGGTAGGTGCTCCAT