Description :
From Genome Similarity Track
Location :
contig_25:766283- 767883
Transcript NameFunction/comments
g5041.t1hypothetical protein

Sequence
1600 bases(100 bases per row)
TTCTCTGACTACACACACCATTTTCACGCGCACGTCGCCAAGCACCGGATTTTGCGTAGTCTGCAGGAGCAACCAGCGCTTCGACTTACCTTTGAGCTCA
AGCGCAAGGCCATGAACATCCACGGCGCGACCACCTTCGACGTGGTGGCGACTCCGGCCCCGAAGGCAACCACTGGCGGAAAAAGTATGGTCTACAACGG
AATGGCGTCGTTCGAGAAGGACGGACACGCCCACGAGTATTCGCTTGTGGATGGAACGGCCTACTACACGCGACGCCCGAAAGACAACTCGGCGGCGGAG
AACGAGTCAGGATGCCTTCCGTCGTACTCGGTTCCGCCTATCGAGAGCGTGTTGAGCGCCATTCACGGTGCCTCCACGGCCACCAACCTGATCAAGCCTG
GTGATCTACAGCAGAAATGTCCTGGTGGATCCGTGATGGTGTTCCCATTCGCAGGTGAAGACTTCGTGTTATGCTCGCACTCGTCGTGGTTCAAGGACGA
CGGGTTTAAAATCCTAGGCTCCGACCTGAACATCGACGTGAAGTATGACCAGACCACGCCTACGATTGTGGCTCCGCACGTGTCGACAGAGGCATTGGCT
ACGTGCGGAAAGGTTCCGTTTGGCGAGCAGATCACTCCGTCGCTGCCATCGCTCATGGCTCGGTCGTTTTCGGAGTGGGGACACCGTGCCCTGCGCGCGA
GGAAGCTGAATTCAGTCTGTGGAATCTCATCACGGATGATGTTTGCGGCTGCAAGGGCGCTGAGCGATCGTGTGTGTTTATTGCTGGCCTTAGCTCGTAC
GAAGACCACGGTTTGACCGATGATGACCCCGAAGGCTACTTTGGCGATGAACTCAGCGACCACACACCGTGTTGTTCAAGCAGGAAGTTCATCACGCTAG
CCACGAAGGATAATTCCTGGTACGATCTTGTGTTCCAGCAACGCCTCGTTGATCTCCTTATTCAAGCGAGCGGTACAAGTGATCCCGCTACAGGAACGAT
CAAGGACACGATCATTTTCGGCCACTCCATGGGAAGCCTCACCTTGGCTGGTGCAATTGCAAACGGCAAGGCCATTCTTGACCCGTCGACGTCTTGGGTG
GCTGCTAGCACTCCAATGGAAGGCAGCATGGGCTCGAACTACATTCAACAATCGTGCAGTGGGTCACAAGATGGCTTCCTGGCCAGCCTCATCGACTTGT
TGGGCAACTGCCCTGCAAACACTGGAGAGTCGTCACTTGTCTACCAGGGCTCGGACCTATCTTCGCAGACGTTGAATGACGCGTATGTTGCTGCGCAAGC
CGCGTACACTGCGAACGTGGATGCCGTAATGTGCAGCAAAAGTTTCACTGCTTGGTGACGCTGAAAGCTGCTATTTACGCGCTTGCGGGTGAAATGCTGC
CGCACCATTCTTCGGAGAACGATGGTATCGTGGAGTACGCAAGCTGCGCCATGGGTCTTCCCCTTGACAGCTTCGACACCTCGTATAAAAGTGTGCGCTA
CGTGACTGAGCTGAACCACGTGGATACGTCGTTCCGGAACGGCGATGGCGTCTTCAGTGACGCGAAGAAACCTTTGAAGTGGTTTGAGTGCCTCCTGTAA