Description :
From Genome Similarity Track
Location :
Scaffold_144:76620- 79066
Transcript NameFunction/comments
g18450.t1hypothetical protein
g18451.t1RAW40520.1 hypothetical protein PC110_g3277 [Phytophthora cactorum

Sequence
2446 bases(100 bases per row)
TACCGCTCAAACCAAGCTTTGCCAGCGCCAACACGACACTGCTGCTCTTTTGACGAACACTGGATGCGATGTGCATGACGTATTTCTCCAGCGTTGGAAA
TACGAACTTCCAGTGCCTTAACAAGAAGCGTGAGGGGAGACATGGAGCCATCCGAGCTAGGACATCCAGTAAGCCTTCCGCCTCAAACGCATCCAGAAGT
TCTGACTCGCTGGTGTTCGCGATACCGTCACTCTCATCGACCTTGTCATTGCGGTTCATGCGGTTTAACTTGCTGATCACTTCCTGGAAAATGAGTAGCC
GTGTTGGGGTTTCACAAAGTGCGGCATATTCCACCAAACATTGGGCCGCAAGCTGCCGAACAGTAAGCTGGTCGTGACGAAGACACTGATAAATGGCTGG
CTTCAGCGTTTGTACTAGACATCGCGGCAGTTGAGTGAACGTGTGGCGCTCATTCAGCCCAAGTCGATATCTCACTGCTGGCGATTGACGGACGCCCAAT
ATGCCCTTGATATCCTCTTTAACCTGAGAGGTCTTGGGGTTTTCGGGTTGTGGAGATGTGGAGTCCATTTTAATGGAGCGCAGAAGATCTGACAGCGCCA
ACAAAGCTCCTTCTCGCTCCGTCCACGCTGTCACTTGGGTTTTGTCGGCGCTCACACTTCGGGAGCCGACAGCGACACCGAGCAAACTGTCCATAAACTG
CTCGATGTGATTTAGGGATGGAAACTCAAACGCGATGGCTGCTGCATTCTTCGCGCAGTCCTTCCGGATTGCAGACCACAAGTCGGTCACACCAAGTAAC
AGCAGCCGAACTGCTTCATCAAAGAACTTGACATCAAATGGTGGCGATGACCCCGCGCGTGCAGCCTTACTCTGCGATGCTTGCCGGAGTATTTGGAAGG
CGAACGTCAGAAAGCGTTGGCGAGCCCGAGGATCCTGAATTCGCTTCACGACTTTATTCAGACTGGAGATAGCAGCAGCATCCCACTCGTTGTCAAGCAG
CAGTCTATGGTACACATCGCAGGTTAGACTAGACGAGGCAACAAGTTATGAGACCAATACTAGTATACCACAACACACCCATGCAGCACATCGACAAAGC
TCTGAAACTCGGCAACGTCGCGTCCCTCCCAGTCGACAGAGATTTGCTGGTCGATCCCTAGAATCAGTTTACCTCCTGCAGAATCGGTCGTAGCTCGAAA
CTTTCGGACCACCAAGTAAAGTAGCAGATCTTCTAGCAATGACTGCGAGTTGTTACGGCATTCGTCGTCGCTATCAAATTGCAAAACAGGAGACTCGCAG
CTCAGAAGGGTGACGTCTATCTGCAGTTTTTCACTTGAAATCCGAGGCTGCAGCAATCGACGAAAGGCTCCGAGCTCCTCGTCGTGGCCTTCAGCTAACA
GCAGACGCCGCACCGACGCCATGCAGCTTGCTCCGCTCTTACAGACTGCGACTCCTGGAGGTGAGGGCGGTTTTGCACACGCATTGAAACTTGCACATGC
ATTAATATACATGGGTTTGGATAAAACCATCACCTGCAAGTAGGCAACCGACGACGAATGACGCGGTGGCCGTTCAGAAGCGTCTCGTGATGCTGCGAGC
GCACCGAGACTGGAAAGAGGGTTTGAAAGCGGGAGTGAAGGAATTCAAAGGAGCACAACTTCAACCGTCCAAAGTCGGGGTTTTCTGAACCAGGCCCAGG
TATTGGCAGGGGGCCAAACTACGACCGGACATTGTTCACGCACCCCATTTCGTCGTACCGCGCAACGGTCGCAATCACGGATTGTGACCTATGCTGTGCC
ACAGCCTGTGCGTGAGCATGAGAGCAGATCAAGGTGATAGATATCCTGTTCCGCTCGTGATCAGTGGTCGCCAAGTCATAAACTGCGGTCTGTCGCCAGC
TATTCGTGCACATTCGGAAATTCTAGCGGAGAGCATCAAGTGTTTGGAGATAAGTGCTATCGTACATGACAACGCTAGTGATGAGTTGAGCGCATGTAGT
CAACTTGCTAGCCAATTATCTGTTATGGTTGTCAGCCTCCTACAAGAGACTGAGATTTCGAGATAGGCGCTTCCCGGTTGTACACCGTAGCGCGATGTAT
TTGTTAGTAACAAGTCATGTTCATGTACGTTGTACACACGTTGTTACCGCAGTCACGAACGCACACAAAAACCTACGCATACATGTATCGACCGTGCTAG
GCAATACACTCACTGTATTGCCCAGCACGGTGTACTTTGCACCTCACACAATCGAATTTGCCGCCACCAACGCCGTTCTATTATACATGATGCGTGATTT
CTTGGTCTGCTTCACACTCGTAGCCTCCCTCGTTTTCTCCGCGCAATCGCAGACGACTGTCATGGTGACTTCAGAATCCCAGTCCAACGCTCGCCCGGTG
CTGTTGCTTACGGGAGATTCGCTCACAGAACACGGCACGTACCCCT