Description :
From Genome Similarity Track
Location :
Scaffold_600:766- 3410
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_600-fgenesh-gene-0.0Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_600-fgenesh-gene-0.1Vacuolar protein sorting-associated protein 35

Sequence
2644 bases(100 bases per row)
CTCTCGCTCGCGACGTCGTTGGTCAGTCGAGCGGCCGCAGCGAGCGGCGCGGACGGCTCGAGCTCCGCGAACGTTCGGCTGGCGGCCGACAGGCGGGCGG
TTCATTCGGGCGAGCGCGGGTCGCGGCAGTGGGTTGCGCGCTGACGCCTCCGGCCGCTCGAGGCGGCTCGGAACATGACGAAATGCGCGCCTGTCGCGGG
TTGCAACGCGCACTAACGACTGATTCGGATCCTTCGTCGCCGGTGCTGGTCACCGCGGGTTCCGTCGAGCAGGAGGGGGATGGATGGATAGAAGCTGTCA
CCATTAACCACCGCTGTCTAACTCAATGGCAGGAGCATCGGTCGAGCGGAGACCGTGGCACTACCATCACCACCACCGTCATGCTGCAGCTGAGACCTCG
AGATTCGAGAGGTGTGGGCGGGTTCATCGCAGTTTGGAGAAGGTATCCAGCCCTTCTCTGCGCGCATAGAAATCAGCTTTCTGAGTCGTGCAGAGACGAG
CGGCGCCTCAACCCGCTGACACAGAACGAACCCGGCCGACCTGCCCGCCGCTTCCGCGGGAGCTGCAACTTGAGTTCAACCTTGAAGCTCCGGGTCGAGC
CATTGCATCCTCCGGCTTGTGCCTTGGGTCTCGGTCGACTATCCCTCGGACGCGGAGCCGAAAATGCCGCGCCGACGCCCCAGCAGAGAGAGAGGCGCCG
TATCATCGGCGTAACGCGTTGCACGCTCGGAGAACGCTCGATGAGTCCCTCGGCAGCTGGTTCCGCCGCAGGTTCGATGTATCGCCCGTCCGTCCAGCAC
AGGACAGGCCCATCGGCCGCGGGTCCAAGTCGCCGCCTTTACTGTGCTTGCTGGGTCGGAAGGAGGAGGAAATCAGCCCGCGTGGCGCGCTGGCAGTCGC
CGGCGCCGGCGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGCCCGGAAGCGCGGAAAGTG
CGCGCACGCCGCTGACTACAGTTGATCGCCGCGCGCTCGCACGAACGGCGCGCGATGTTCGCCGCGCAGAGGCGCGAGGCCGGACGTGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGACACGGGGAGGGGCCGAGCGAGCGGCGAAGGCGGTCCTTGTGCCACAGACTGTTGGGACGAGGTCGGGACGAGGTCGG
GACGAGGTCGGGAGGACCTAATGAGGTGCTCGCCTACGGTCGAATGAGGCAGTCGGCCTAGCCAGCGGTGGGACGAGCTCGCTGGTGTCGACAGAAGGCG
CGGGCGGAGGCATGTGGCGCGCCGCAGACGCGGCGGCGTTCACTTGACTCGGCACCTCGCAGCAGCTAATTTCTTCGCATATAGTTTGTCGCCTATATAT
ACTTTGGAAAAAGTTTCGTTACTGTAGGCAAGTGTAGGTGAGTGAAGAAATTATCGCAGACCCGCACTGTCCGCAGTGAGCTGGCGGGTACGGTACCGCC
TCAGGTCCGACGACGGCCCGTTTATCGCCCAATCAGTCAGCCGAATGAGGCCGTCGCCATCAAGTTTGCGCGCGTTTCGACCAATCGCGGCGCGGATCAG
CCGCCCCCTTCTGCCCAGCTGTGACGCGGAGAGCAAGCACGATGGTCAGTCAGGCCATCATATATTCGCGAGGGAGCGACGTCCTGTCCTCCTCCCGTTC
TCGACACCTCACGCCGGCGCGGAAGCCTCAGCGTGAGCTCATTCCCCAACACGCACGCGCCTCGTCGGACCAACCAGCCGCCCAGCGCGATCGCATTGCT
TCGGCGCTTCATATCCCAGCCACAGTAATATTCGACTCCTGACGCGACCGACCGAGACAGACATGGGCCTGCACCACAAGATCTCGCCGGCAATGCTGGA
GCAGGTGGCCGCCAAGCTGACGCGCTACTCGCGGTCGCTGCGCCTGCAGCTGCACGCGCTGCGGCGCGAGCTGGCCGAGACGGCGCGCGCGGTGGCGACC
TCGCACGAGGACCTGCGCGAGTCGGAGACGCGGCTGCGCGAGATCGAGGAGCTCATGGACGGCCACCAGGTCGAGATCGACCGGCTCCGCGCCGCGCAGA
CACAGGCGAGCGAGGAGGGCGACGAGCTGCGCGCGCGGTGCGACGAGCTGGAGGAACTGCTGGAGGAGCGCGACGAGGAGCTCGAGCTGCTGGACCACAT
CCGGTCCGTGCTGCTGATGCAGCAGGCGTCGCGCGCCAAGCTGCAGACGCTCGTGGCGGGGATCACGCGCGAGCTGGGCAAGGTGCGGCGCAATGAGGAG
ACCATCGTGCTGGTGGCGCTGCGCGGCCGCCTGGTCAAGCTGCCGCCCAAGGCGTAATTGGCGCTCACCGAGTGTGCGCGCGCCAGTGTCTGTCTATTTA
AGTGGAGAGTGTCGAGAGTAGCGTGTTATGAAGCAGTGCAATAGATGATCTGTCGTGTTGAACGCCCCACACTCGTGCTAGTTAGTTGGTTCGCCTGCAT
TGGAATGTGAGCTGTTGGTGTGGCGATCGAATGTCTGTCCAGACTGTGCATACCCACCCAGTCTTCAACATCGCACCAATTTCATGTGGCATACGCTAAA
CAACCACATACTCTGTCCAAGTATAGACCGCTTTTCGACACCGC