Description :
From Genome Similarity Track
Location :
Scaffold_171:76596- 78240
Transcript NameFunction/comments
Phyci_97539Major Facilitator Superfamily (MFS) putative

Sequence
1644 bases(100 bases per row)
GCTGGGCTCCGCTCCACTCTGCAAGTCGCCCTGGAAGCCCCCGCACCCGTTCGTCACTGATATCTGCATCCACCATGGCGCTCTGGTCCAGGGAGGGCGT
CACGCACAACGTGTGGACCGCCTACGTGTTCACGCTCTTCTTCTGGTCCGCCCGAAGGTACTCGACCTCTCCACAAATGTGTCAATGCTCCGTCCACTGC
TAGTGCAGCTAACTCCCGCCTCCATTGCCGCCAGCATTCTGTTCCAGCAGGTCGTGGCCGGCTACGTGTTCGTGCTCACGGCGTCCAACAAGCCCGTGGG
CATCGTCAAGGGCATTCAGGGCATCTCGCAGCTCGTGTTCTCGCTGCCCGGCGGCTACTTCGCCGACCGCACGCGGCGCGACACGATCCTCAAGCTCTCG
GGCGCCATCGGCATCGTGGGCGCCGTCATCACCTTCTTGTCGGTCGAGATGACGTCCGTCACGGGCCTGTACGTGGCCTTCGGGCTCTGGGGGCTCTTCG
CGGCCTTCCAGAGCCCCGCCATGGAGGCGCTGTTCGCCGACTCCATCCCGCCCGGCAAGCGCAGCTTCCCCTTCATGATCAAGTACAACATCAGCAACCT
GGCGCAGATGCTCGGGCCCGTGCTGAGCATCTTTCTCTTCCTCTTCTACGGAGACGAGTGGCAGCTGCCCGAGCTCAAGCCCGTGCTCGAGTTCGGCTGC
GTGCTGGCGGTCGTGGGCTCGCTCACGCTCTTCCAGTTCGACGACGACCGCGCCAAGGACTACATGCTGGACAAGACGCaggaggagaaggaggaggagg
agCTGCTCGAGAAGATGGTCACGCCGTCCCCGCTGCGGACGCCCAAGCTCGTGGGCAATGGCAGCGAGATCGACATGGTCTACGACTACTCGGACGAGGA
CGACATCACAGTGGACGACAAGTCCCCGCCCACGGCCACGGAGAACACGGCGCTGCTGCTGCTCAAGGGCAAGACCGCCAAGGAGATGGATCTCGAGCGC
CAACAGCGCCTGCAGGAGGAGGACGATGAGGAGGAAGGGTACATGGCCCACCTCGACGCCAAGTTCCTGTGCTTCCGCACAAAACACGTGCCGTACGTTC
TGTTCGTCTCGGACTTTGTTATCAGCAACGGCGCCGGCATGACGATCAACTTTTTCCCGTTGTTCTTCAAGGAGGAGTACGGCCTCACGCCGATCCACGT
CTGCGCGCTGTTCATGAGTCAGCCACTCGTCGTCATGATCCTCTCGTTCATCGCGCAGCGGTTGTCCAAGCCATGCGGCCGCATGCCGATTATCGCCTTC
ACGCGCGCGTTCTCGGTGGGGTGTCTGTTTTCCATGGCTTACGCCCAGCCGATGACACTGCAAATCGTCTTGTTCTTGATGCGCGGTGGCATGATGCGCT
GCTCACAGCCCCTGCGTCGTTCAATCCTGATGGACTACGTACCCAAGAACATTCGTGCGCGCTGGAATGCGCTGGAAGGCTTGTCCGTGTTCTCCTGGTC
GGGAAGTGCTGTGCTCGGAGGCTTCTTGATCGACGCGTACGGCTACCGCATGTGCTTCATTATTACGTCGCTCGTCTACTGCGTGGGCTTAGGCATGGAG
ATGGTCCTCTTGCCCCTGACCAAGCACGCCGTTGAAAGATAGAG