Description :
From Genome Similarity Track
Location :
Scaffold_856:7659- 9149
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_856-fgenesh-gene-0.1Helicase, lymphoid specific

Sequence
1490 bases(100 bases per row)
GGCGGCGTGCTGCGCGACTACCAGCTGGAGGGCATCCGCTGGCTGTGCAATCTCTTTGAGAACGGCCTGAACGGCATCCTGGCGGACGAGATGGGTCTCG
GCAAGACGATCCAGGTGATCGGCCTCATCGCGCACCTCAAGTCGCTAGGCGTGCGCGGTCCGTTTTTGATCACGGCGCCGCTGTCGACGCTCATGAACTG
GGAGAAGGAGTTCCGCAAGTGGACGCCAAGCATCCCGTGCCTTGTGTACCACGGCACGATGGCGCAGCGCCGCGCGTTCCGCAAGAACGAGCTGACCAAG
ACGCGGAAGAACGACATGGACTTCCCCGTGGTGATCACGTCGTACGAGATGATCCTGGCGGACGCCAAGAGCTTCAACAGCCTGGGCTTCGTGTGGAAGT
ACATCATCATCGACGAGGGCCATCGCCTAAAGAACATGGACTGCAAGCTCGTGCGCGAGCTGAAGAAGGCGCGCTCGGAGAACCGCCTGCTGCTCACGGG
CACGCCGCTACAGAACAACCTAGTCGAGCTCTGGGCGCTGCTCAACTTTATCCTCCCGGACGTGTTTGACGACCTGGAGCTCTTCGAGAGTTGGTTCTCG
TTCACCCCCGATGGCGCGCGGGACGGCAGCGCCGCGGCGCAGGACGTGCTCGCGGGCGAGAAGAAAGCGGAGATCGTGTCGAAGCTGCACGAGATCTTGC
GTCCGTTCCTGCTACGTCGCCTGAAGGTGGACGTAGTCGAGGAGATGCCGTCGAAGACCGAGATCTTCGTATACTGTCCGATGACCCCCGAACAGCGCGA
GTACTACACGATGATCGCGAACGGTACACTGCAGCAGGTGATGGAGGCGAAATACGGCAAGTTCCGCGGCGCGGCGTTCAAGACCAACAGCATCAAGAAC
CGCGCGATGCAGTTGCGCAAGTGCTGCAATCACCCGTACCTGTTCGACGAGCCGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCGAGCGGCTGATCGAGGCGTCCGGCAAGCTCCAGGTGCTCGACAAGATGCTCACGCAGCTCAAGCGCGACGGCCACAAAGTGCTGATCTTCAGCCAGAT
GACGCGCGTGTTGGACATTTTGCAGGATTTTCTAGACTTCCGCGGCTACAATTTCTGTCGCCTGGACGGCAACACGGACCTCAAGTCGCGTCAGGACCAG
ATGGACGCGTTTAACAAGAAAGGAGGACCTAATGGAGTCGACGAAGAGGACGTTTTCTGCTTCCTATTGTCCACGCGCGCCGGCGGACTTGGTATCAACT
TAATCTCGGCGGACACTGTGATCTTCTACGACTCGGACTGGAACCCGCAGCAGGATAACCAGGCGCAGGACCGTTGCCATCGCATCGGCCAGACCAAGGA
GATCGTGGTGTATCGCCTCGTGACTGAAAACTCGTTCGAGAACCGCATGATTGCGCGCGCAATCGAGAAGCGCAAGCTGGAGCGTGTGGT