Description :
From Genome Similarity Track
Location :
Scaffold_755:7658- 9925
Transcript NameFunction/comments
Phyta_totarag10543hypothetical protein

Sequence
2267 bases(100 bases per row)
CCACACCAAGGAGGGCTGGAACCCGAGGGTGTCGGCCGGAGTTAACGTAGAATGGTGTGGTCCTTTCGACGAATGTACGGCGTTATCAGGTACGAACTTG
ACCATGGGCAAGAACGTGCTCCACGAATTGTACGACGTAGCGAAGCTTCGCAGCACATCCTCGACCACTCTGATCACACGTTCGGTCTGGCCGTCCGTAT
CTGGATGGGCCGTGATGGACATGAGCAACCGCGTGCCGAGTAACTTGAAGAGGTCCGTCCAAAAGACGGTAGTAAACCGGGGATCTCGCTCGGACACAAT
CGAGGTGAACAGACCGTGGTGTCGATACACGATGTCAACTAAGGTCACCGCGGTCTGGTCCGCGGTGGTTGTGCAGCAACCGGAGCAAGATGTACAATCT
TGCTGAACCTATCAACGAAGGCGAGGGTACCGGTGCGACCTTGAGCATCGCGAGGGAGGCCAAATAAAGAGTCGATGTTCACCAAGCTCCACGCGTCCGT
CGCGAGACGAAGTGGGCGATGCGAAGCCTGCTTCGACAGAGTCGGGTTGACACGCTGGTACGTTTCACAGGAGCACACCTACTTCTGCACCCACGTGTAC
ATAAACGGGCAGTAGAAGTCGCGAGAGAGTGACGCAAAGGTCTTCTCACGATTGGGGTGTCCACTGCTTGGGGTGTCGTCAAATCCGTGAATCAAACGAG
CGCGGAGGTCGGCTTCAAGTAGGACGCCGATACGTGAAAGGTCCGCACGGTCGACGCGGTAGGTCAGCAGATTCTCGCCCAGGACGTACCGGTCTATTCG
GGCACGGCTTTGTCGAGTAAGTTGGTGGCTAGCCGTATCGAACTGTTCGCGCAggtacttcttcatcttggacaTACCATATCAGACTCATACGCGGCTG
TAATAAAGTCGCGAAGCGGGCTGGTCGCTGTGCCACACAGCCCACTCGTCATCATCTACGTCGCCAACTGTGACGACCCGACTGCACGTAGTCTGTATGA
CATGTGAGCGCGTCGGCGAGGATATTGGTCTTGCCCAGCTTGTAGTACACAACGAAGGTGTACTCGGAGAACAGCGAGAAACAGCGCGCCATGCACTGGA
ACAAATGAGGATTCTTCGACGCCGTCTACAGCGATGTATGATCAGTGTAGATGTTGAAGGGTTTCTCACCCCGGAGGTAGACGCGGATTTTGATCAGTGC
GTAGCGCATAGTCAGACGGTCCTTGTCGTGGACGGGGTAGTTCCGCTCTGTCGACATCAGCTGACGTGAATGGTAGGTCACCACTTGCTTGTATCGACAC
CTCGTGTAATAGCTTCGAGTGGTCAGGTAGCATCAGGGCGGGCGCGGTGGACAAGCTTGTCTTAACCGCGTCGAAAGCAGCCTATTGCTGTGGACGCAAC
GATCACGCGGCGTCTACCTTGAGGAGTTGAGACAACGGACGGACAGTCGAGTAATTCGAGTAGTGGTAGAGGTAGGGCACGAGACCGAGCCACAACTGAA
GCAGTTTCTGATCATGGGGCGTTGGCTAGGCACAAATGGCCTCAACTCGCACTGGGTCAGCACAGACGCCTTCCTTGTTGACGCAGCTCCCGAGCACCGG
GATCTCGGGAGCGTAGAAAATGCACTCGTTCATGTTGATGTACAGCTTGTTCTCTCATGACTTCAAACACTTGGCGGCGGTGTTTGAGATGCACCTCGAC
GTCAGTCATGCCACCATCGGCGCGActgtggatgaagatggcgtcgaagTAGCTAAGCGCGAAGTCTTCAAATGACCGCAACCATGGGGTTAACGGTTTC
CGGGACGTTCTCGAGCCCCTGTGGCATCACGAGCCATTCCCGTAGCATGCCTCTGGTAGTGCTGACTGCAGTCAACGGCACGTCACTTTCTCGCATCAAG
ATTTGATAGAAACCATCCATCAAGTCAATGGTGCTGTATTTGGTACTGCCGGACGTGGTGTCAAGGACTGTGTTCTTCCGCGGGAACGGCGTCTGCGCCG
GAATGGTGGCGTCGTTGAGCTTGTTTAAAGCGTTGACGATCCGCCATTCGCCagtggccttcttcacgaaggAAGTCGGCCTGGAGCGCGGGGATAGGAT
GGCCTGCTTGTCGACAACTCTCGAGGAAGGCGTGGATTTGCTTCGACATGATCTCAGGGATGCGGTCGCTGCCGCTCCACATAGTACTTCGCGTCGGGAA
TGAGCTCAATCTCCTGCCGAACTTGACGGTCAGAAGGAAGGACGGCTCGAACCTTGTCCGGAAAGAC