Description :
From Genome Similarity Track
Location :
contig_6:765788- 774928
Transcript NameFunction/comments
g1907.t1hypothetical protein

Sequence
9140 bases(100 bases per row)
CTTGTTGGCTGGGATCTCGAGCCACATGACGAAGTTGGTCGAGTGGCCTGTAGTTGACAACGTGCCTGTCCGCGTGAGGATCTTGTAGACCGGACAGCGA
TAAATGCCACGTTGCGGGGCCTCGCGATGAGGCTGTGGGAACAGGTGAATGACTGGCATCTTCGCGAATAACTCGCGCGGCAACGGGTCGTCCAATGCGT
TAACCTCCGGGTTCCAGCGAGCGCCCTCCAAGAACAAACCGTAAGTGTAGCAACCATCGACAGGCCGCGTAACGAGCTGCTCGACACTTTCGCGCATCAT
GATGAACTGGAAAGACAGCGAGTCGATCGGCAGTTTGTATCGCCGCGCGTGGTTCTGAATCGTGCCAGTCATGAAACCTTGCGGGAAGAAGAAGCCCGAG
ATCCAAAAGACGGCCGGAATGCCGTGCGCGATCCAGTTGGAGATAAACGCCAGACGCTCCAGCAGGTCCTTCACCCAAGCACCTAGCGGCTTGAGTGACG
GATAAGCTTTTGCTTCCCAAACGGCAGGGACCTTTTGATCATACAGCGATGCGCCCATGGCTTCCAGTTCGGCAGACATGACTACAAGACCTTTGAGACC
TTGTTGGACAAGATGCAGCGTGCTCCGCATAACAGCCAGCAGCTTGTTGAAGCGTTCCACCTCCTGTGCCAGTACCGTATTCATGGACTCGTCGTAGCAC
ACAGGGTATGCCGCCTGGACGTGCTCCAAGTCATATTGAGCTGGTAGCTGAGACGCAATGGCCTGAGCAGCATCCGCGATAATTTCTTCGCGGCTCTTGC
CTCCACCAGAACTCACTCTTGGTTGCAGAGACAACAGCAGATCGAAAGCCTCATACGTTTCAGCCTGAGCACTTGTGATGTTCGCGTTTTCGTGCATGCC
AAAGACTTCTGGTTCCGGGTTGATCGGCAGTGAATTAATGTAGTTCACGTAGCCGTCGTACGCATTGCGCGGATCACAATCCAGCGAGTAGTAGATGCCG
CTCTTTGAGAACGCGTAGTCCTGGTGTAAGATGGCCTCTTTGAAGAAGGTCATGAGGATGACATCCGACGTCCGCATATCCTTGTCGTCAGTGATTCGAC
CACCGTAGTTGATGGTGGAAGTCATCACCTGCAGCACGTCGAAGGGCACATGGTCGTAGGTGTCCAAGAACATCTCGAGCTGCGCCACACTAATGTCCAA
GTCCGTCTCATTGAACTGATACGGGATGTTCCACCCGAGAGCACCAAACCGCTTCCGCTCGCACACGATAGCATGGTAGAAACAGAGTCCAAAGAGCAGT
TTGCGGAAGACGTCGGGCTTTCGAGTAGCTCCAAGACGCGTTTCGTCCAGTTTGTAGTAAGTGTTCTTGAGATTCGCTCGCAGTCCCTTGGGTGCCTCCT
TCGTCATCTTCACGCCATCCTGCAACACCGAGGCAGGGAACGCCGGTGTCGGCATACTCGTAAGCCACAGGCGGAAATTTTCGTGTAGTTTGGTAGGGTC
GAGTTCCTCGCATATTCGCTCCAACTCGGGCATCCAACTCAGAGCCAAGTGGCAATTCTGCAGCAAAACCCACTCGCCCTTTGTCGTGGCACCTTCGATT
AGCCGCGCCGCCAAAGTGCCTTGGCCCTGACCCAGCGCAATCGATTTGAGTTTGCTCTCCATGCCTGTGCTTACAGCAAATCCATGAAGGTCCTTGGCCG
GATCGGAACCTTGGACAGCACAAAAATCAAAGGCGTCGTCGGGGTTGCGTCTTCAAACGTGTTGGCGAGGTCGAACGGCGGCGGCTCAATAAACTCCTTG
CCCAGCTTGGCACACACCAAGTTTTGAATCCCGGGCATCATCTTGTCTGGCCGTAGGACACGCAAAATACACAGTCTCTGGAATTCGTCAAGTTTGGACA
AGAATTCACCAGGCAGCGGCTGATTTTCGGGATCTGTCGAGTCAAAGATGGCTCGGAACGCTGCAACATGCGTTGCAAACTCAACTTCAAGACCTTGAAA
TGAAGTAAAGCTGGCAAGGGCACAGATTTGCTGCCACGCATACGCTTCGAGCCATCGTGCAGCTGGGTTGTCGGCCTCGACAGGTGGGTTGGATCCGATC
CCTGAGAGCAAGAAACGCCACTCGCCAGCATCCACTTCGTTGTTCCCCTGCATGATCTTGATGGTCAGCAGGAAGGAGAATAGCAGTTTGTGCTTCTCAA
AGAGAGACCGACAAATGTTCTTGTAGACGGAGTACGTGAAATACTCATTCAGGTTTGTGAGGCGAGTCTCCAGTTGGGCAGACGGTTTGGCAGCTTGAAT
GCCGCGAACGAAAATCCCCGTGAACCACGTCAGCGAGTATTGATACATGGGATCCACAAGTGCGAGGTCGGCGATGCAGAAGAACAGCAACGCTGCTCGG
AAGGCAACCGGACGGTAACCGTCACTGCGCGCATCAATTTCGCGCTCGGTTTCTTCGGCTTCACGCATCTTCGCCATTACAACGGCGGAGGTTTCTTTCG
CCGACGCTAACGTCTCGATGAGGTTTGTATCATCCAAAATGTTACCCTCAGAGTGCGACAAGAGGTACAGGATTTGGTTTTCGATCTCGTAAAGCTGCCG
TTTACCCTCTGCATTTGATAGCACCAGTTCATTCTTCTTGGCTGCGAGCTCGGGTAATTCTTTGAGCACCACCACACCCAAAAGCTGCTCCTCGAGGCCC
TTCATTGTAATCGTAAAATTCAGCAGACTCACTTTCACGCAGACTTCCGGTGCGTAGTGCGGGTTTGCTAACTTGGTAGTGAGGAAGAAGCGAAAGCTGT
CGTTGTACGGAATCACGTTCTCACCTAGTCGGATCATGTCCTGACCTCCCTGTTTGAATTTCTGCTGCAGCAGCACAGGCTCCAAAGCGGCATCAAGCTC
CTCGCCTACGTTCTCGAGTAACACCCATTTGCCGAAGCGCAGACCGTTTTCTAGTGCACGGAGGAATCCACGGTCTGACTGTTTGACCACATCCATGCCA
TTGTCACAAAGCTTCTTATCGCGTCCAAGGTTCTTGATAAAGCGGTTAGCTTGTCCCTGTGGGTCAATTAGCAAGGGCCATCTTCGAGCACGCCCCATGA
TGATGCCGTTCTGCGTCGAGACTGTATCAGTAGGCAATCCAGCGATCTGCCACGCGCGCAGTTTTACAGGATCTTGCAGGGTCCGAATCAAATCGCAGCC
TGGAGAGTGAGGCACCGCGTGCTTTACGAGAGCTTCATGCCATGAGGCCACAAGTTGCTCACGGAACTCGGCCGTAAACGCACCCAGATAACTAATCGTG
CCGGCTGATACAAGCACGTCTCCCGTGAGGTTGGCGTAGTCTAGTGTGAGCTGGGCGACCGTTTCCTTCCAGCGAGCTTCCTCACCGCCTAGACCGCCAA
TAAGTCGTTCAGCATTCTGCAGTTGAACTTGACACTGCACCACCTTTCGTCCGAGCTCCTCCTTCTTCGCCACAGCACCATTGTAGGACTGTTCCAACTC
TGCTAAACGATCGCTTACTTGCTGCAAATTCGCTTGTGCACTCTTCAAAATTGCAAGCGTCTCATCCAACTCTTTTTGCGCCTGGGCGAGGGCTTGCTTC
TTAGGCTCGACAGCCTTGGCCACGAAATGATACGTGTACATGGCGCGTGACCACATACAGATTGCAGTACAGGCCTTCGAAGACTTCTCGATTGCCTCCG
GTGTGAAGTTCGGGTCTTCCATACTAGGCGCAACTTTCGTGATAATGGCATCTGGAATGTTGTCCTTGTCGAAACCGAGCAGGTTCTCCAAGAACTTATT
CGCATTCGAGAGCACCACCTTCTGTGCAACCTCCCAGTAGTCATTGATCTTTTTGCCAGGGCGATCAGGGTCAGGCTTGCTCACAGGCTTCTGACCGAAG
AGCATGCACACCACTTCCATTGTCAACTTGACACCAGCAGGTGGCGTCTTGAGAGCTTTGACCTCATCGATATCAGACTTTTTCAACCGATTCAAACATT
CCACAGCGGATTCCAATGCTGGTATAGCAGCATCGAGGTCACGTTGCGCCGAGTCTGCGATTTCCTTGGTGGCGCTGGCTTTGATACTGGCTGCTGCCTC
CTCTTTCTCAACCGTTGCCTTTGTCACATCTGCTTCGGCACTGTCCTTCGCGATCTGGACCATCATTTGCTCCACTTCCAGCTGCGTAGCAGCAAGAACT
GGTTGAAGCTCCACAAGCTCCGTCTGCATCGTTGCAACAATTTCCTTGGTTTCTGACAGCTTGTCCACGCCGTTTTGCAGACGGCTACGCATCATATTCA
CTTCCTCTCGTTTGCAACGAGCACCGACTTAAATGCCGATAACAACTCCAAGTAACTTGTCGGAGTCACGTAAAAGTACCTTCGTAAAGTATTGTAAAAC
TGTTTGGAAGCCTCTTCCACGCTTTGATGTACAATCTTGAACGCCTCCACAAGCGCTGGAAGCTTGTCGCCGAGTGCTAAGTTACCATCGCTTAGAATGG
CAGAGGCGACTGAGTTTAGAGCTTCAGCAGGCCATTCACTGAACCAATCGATGGTTGAGCAATTCACCAGCGACGGGAACATTCGAAGCCGGTCACGGAA
CAAGCCGCCCAGGGGGCTCATGCAGATGACCAAATGAATGTTGCGTCGCACACGGTTGATATACTGCTGGAAGATGTTGGTCTTTGTAGGAGGGAGCTGC
CTCTTTTGACAGTCCACTCTGCATGCTGTGACGATCTGATCCAGGTCTTCTGGGCCGTAGAGATTTGGCACGTTACCAGCGTTCAAGACACCGTTGAGGT
CTTCTAGCATGGTCTCATTGACCACTTGTACGTCTGAAAAGAGGAAGACAACCGGCGTATCTTTCACGCCTGCAAGTAACAAGCACTTCTTGACGTCTTC
ACGCCACTCGGTGAGTCCATAGCCCTTAACAATCTCCACCTGGAAGCACTTGTACCCTGCCATGAACGTCGCGAGCTTTGTAAGACTCTGGCGACCACTA
CCACCTACACCAAGAAGTAGCGCGTTGCCCATGGGCTGTCGAATGATTCGAGAGATGCGCGAAACATGCTCGACAGCATCCATGAAGAGCACGAGCGACA
TGGGCGACTTGCTCTCTGCGTTGTAGTCGAGTAGGTATTCATCCATAATGCTCAGCACCTTGTCCACATCAACCACTTCCTCGTAAATCTTTGGATCAGC
ACCTGGCACCAAGTAGTCGCCGTAGATCAGATGCTCATTTGTCACAACCTGATCGTACTCGCGCTGGAAAAACTCGTTCGTCGATGAGCGCATGAGCTCG
CGGAACCAGTCGTGGTCCTGCAAAGACACCATTCGGTCCTCATAGACTCGCTTACACTCGTGCACCCACAGACGAATCAACGAATCCGCTTCCGTGATAC
GACGACTGTCACCCATGAGGACACCCTGGAAAACCTTCGCCAGATCACGCAGGTTGAACGTATAGTGAGACTTAGCTGGCGTGGGAAGCAACTCGCGGCA
AATCGTATTGTACACGCTGATGGAGGCTCGGACGACATTATCGGTGAGCCGCGCGACGTCACCAGGGAAGCCTGAGCCCAGAAAGTTACCAAGGATGGTG
CTGAAGATGATGGTTTTGCTGTCATCTCCAAGTTCAGCATAACCAACCACATTGAAGTGGCGTACCAGTCGAGAAGTGATTGGGTTGCGCCCACCACCAG
GAGGACCCATGGAGGCTACGAACAGAATGTCGATGATGCTACGGAAGACGAGCAGCTTGCGGTCGTACCAACCGCCTTGATCGAACCACTGACGCACCAG
CTCCAGAGGAGGTTGAGCAAAGTACTTTTCGCGCTTGGGCATGTTCAGATCATCCACGTAGATAATGTACTTCTTGCCTGCCGGTGGGCCGTAGACACCT
TTCCGTCTCTTTTCCATCTTGGCATCCAGCATGTCCTGCGTCTGGTTAGCAGACGTCTGCGCTGAGAAAGAAATCGGGATTGGAATGTAGATATCCGCCG
GCAGGGACTGCAAGTAGCGCGTGATGTTCACTGTCTTACCAGTACCAGTGCCGCCAACCATGAGGACGTGTTTGCCGGCGCTCATCAACTCTTCGAGTAG
ATAGTTGTTGCGCACAGAATCAGCAGTAGGCACAACGATTTCGGCGAAAGACGAGTTTGCAGGAACCTTGTAGGACTGACAGTGCTCATCCAGGGTACCC
ATTTGTGACTAGAGAGCTGATAGCAGTAGTCGTAGACCAGTCCCGTAGGCGGTAGTGGAGGGTTGCAGTTGTTCGCCACCAACTCGCTGCGCAGGAAACT
ATCAAATCGTACACGACCAGCATCGTTTGTAGAAGCACCCACAGACCAGATCAGCGCAAAGATGAACAGCGGCTCAATGTCGTCCTTGAACTGTGCGCTC
GGTGATTTAGATGCCGGTTGAGGTTCACCGGTGCCATCAGCCGCAGGCTTTTCTCGAAAGGGTCTAGTGTACAATCCAGTATGTTCATGAGGCTCTGCGC
TAAATTGTTATCCATCGTGGGCACGAGCTCACCCAAGAAAGAGCGAACGAACGTGACTGACGAATACAAGTACACATCAAAGAGCCACATGAACACGTGT
GCGAATGGTGCCACCGATTTTGGAAGGTGTTCGACCCACGAATCGACAAGTGGACCAAGGCCAAGTGTACTTGGCTCCATGTAAACCATACCTGTCCGAC
TAACAGTAGCCGGAGAAGCCACAGATAGATCCTCCACCTCAAACATCATCGTCATTTGCTTCGACATCTGCAGCATTTCACCACTATTGAGACAAAGCTT
CTTGTTGTCGTCAAGCACAGTGTTCATGTTCTCAATCCAGATAGCATCCACAGGCCCGTCAAAGATGACCCATTTACGGTCAGGCTTTGTGTCGCTTGCA
GCCGCACGATACAGAGTGGATAAAATACCATCCTGCCACTCGTGCGTGTTGGCATCAAAATTCACCGTAAAGCTGCCCCATCGTGATCGATTTGGGGTTG
AGCTGGTATTTGATAACTTCTCAAACGCGAACCCGGATTCTCCCCGTTCGTTTCAGTTCTGTAAGCGCGTCGGCGAGCACTGCGATGTTGCATGACTTGC
CACCTCCAGTAGCACCGACAACCATGAGACCGTGTCGCACGACGATTGTTTCATACAGTTGGATGCACTTGGTGAGGAAGTACGGAACAGGCTGTAAATT
CAGGCGAAGGGTCTGCAGTTTAATCACACTAATAAGCGCACCAAGATCAAGGTTCGGACGGCATTTGCCAGGGAACAAGTCGCTGATAATGCCGTTGAAC
AGCGGGATATCGTGCGCCAAGAATTTCGGTAGATTGACATCCTGTAGCGCCCGAAGCAGCAACACGTCTTCATCCATGTCGGGATCATCGCGCTTGAGAT
TGCCTGCTGCTGTGATCACCGTTTTCACAGCACGCATGCCGTAGTCGTAGTGGAACTGGGACGAGAGCTGCTCCGAACAGAGCTTGAACGTCGTCACCAT
TTTTGCGCCAAGCGCACGTGCATCCGAGAACCCGTAGGCAAAGAACATGATCTCACCAATAAGCGCGTAATCGGGGACCATCATAGCCACCGGTCGAAAG
AGCGCTGCAAGCGAGTCGGGTAGTTCACTACGCCCAGCGTAGCCAGGATTCATGGTAATGAACACACCAAACTGGTCGCTCAGCTTGATATCCGATCCTT
CAAACACGATTCGTGTATCGCCGCGACGAATGCCAAGCTGCAATGTGACCACCTGCTGTCCTACGACCGACAGCACTTCGATATCGATACGGTTAAACTC
ATCGAAGCACGCCCAGGCTCCACAAGACGCCAACCCCTTGAAGAACTTGCCCATGGCGATGTAATCCAGACCATCAGAGCAGTTGAACACAACGCACTGT
TTGGCCAGTGCCTTGGCCAAATCCTTGGTAGTTTCAGTCTTTCCTGTTCCAGCCGGCCCAGCAGGTGCCCCACCTAGGATCATCTGAAGGGCACCCATCA
GTGTGAGGTAGCATTTATCCGTCAGCGGCGTGATCACCAGTCGAAACGAATTCCCCAAGTACTCGTAGCCGTACGGACGTCGTGACGTCACTGCTTGCAC
CCACAGGTTCTTGTCCGCCCAGTAGTATTTTAGCTGAGAGCTCCACAGAAAGTCTCCCTTCGACTCCACATTTTGAGCTACAAGTTTGCGAGTGACATCT
CGGGCGTGCACATCGATAACCGTCAGAGCACCACACGTGATGCGAGCCATATTATCGAGGTTACCACGCACGAGCGTGACCATGTCAGCTAGCTGACCGA
GTTGGCGAGTCATCATTTTTTGCACGCCTTCACGTCCATCGGCATCCATGGCCTCTTCCATCTCGCGCGTCCAGTGCATTTGACTGCCATTAAGCACGCA
CATCCCCGGCCACTTTTGAATCCATAGTGATCGATCAATTTGTGTGTAGTTCGCGATAGCGCGCTCCATGATATCGCGGATGGACAGCTTCATCATGTCT
TCGACCTCCATCATCCAGTGCTCCACGTTCTTGCCCTTGGGGTCTACCATGGTCGAGAACGGCACCTTTTCGCCTTCAGCTGAGATCATCGCACTGATAT
TCAGATCGTCTTCAAAGGTGACCTGAACGATACCTTCGAAGCATTTTTTCAAATGTGGCTGCACAAGCTTGACATCCTTGGACTCTGATAGGATGGACAG
CAACTCGTCGTTCGAGAGGAAGTAAAATCGAGCGAATGCTGAGCGCTTGACTTCCAAATAGTCACTTAGCCCTTTTTGCACGAGCTCCAGGAAGTGATTC
GATTCTCGGAATCTCTCCAACAACTTCGTGCTCCGGCAGAACTCGACACACTTTGGTTTGGCTTTCGCAGATGCCAGCGTTTGGCGCCAGTTCTTATCCA
CAGACGCAAACCGCTTGCCCTCCGCAGGAAGCTGCTTGTTAATATCGGGAGACTCGAAAATGGGCTGCAAGTACAGCCAGTTACGCTGCACAGCCAGCCA
CTCTTCCAGCACCTCCGAAATAAGCTGCAGAGTTGTGTTCCACTCGACGATCTCTTCCTCAAAGGGTCCCTTAAACGATGAGAACATCATGGCTTGTGTC
ATTGTCACGTGCTCATCCAGGATTGCCTGAATTTCGTCGA