Description :
From Genome Similarity Track
Location :
scaffold_16:7657- 10019
Sequence
2362 bases(100 bases per row)
TTCACATGAAATGGCGAATGACCTGTCGAGAGATGCGTGGAGTTGTTCAACgtaaattttgcaaaagaagaaaattcaGTTCACTCTTTGAGAGACGTAG
TGTGACTACGCGGTACGTCGACTCACACGCTCTGTTTGACCGTCCGTTTCAGGGTGGCATGGACAAATTAGTGCCCATTAATCCAAATAGTGCACGCCAG
AAGTTCGACGTCAAACGGGTATCACGGTCAGACACGATCTCAACAGGAAGGGTCTACAAAGATCTAAGCTGTCTTCTCGGTAGAGATCTTGTCCGAAACA
GGCGCAAGATGAATCCTCTTGCTAAATCGGTCCAAAACACAAAGATGCCACTGCGTCTATGTGTGTCACGCGGGAGTCCGAGTATATAGTTCGTACTCGC
AGACTTTCAGCTTTCGGTTGGCGACCGAAGTGAAGCCTGAGTGGAACCTGATGGTCTCACTCTCTAGCGAATCTCTAGTTTTCACATTCTTGCGTACCCA
ATTACACATGTGCGGCCAGTAGTAATCCTAGAAAAGACCGACAAACGTTGGCTCACATCCGAGTTGGCCACCCGTAGGGCTGTCATGGTACTTATACAAA
AGACGATGACGCAAACATTCGTCATTTGGAACAACATTTCTTGCTGTATCCCCGTGTCCTACCGCATCGTACAACAATCCGTTAAGTACTCCAATATGAT
GATCACACGATATCGTGCGAGACGGAAGACCTTGAAGTGATTTGTTGGAAGGGTCATTGAAATACCGCAACAAGTCTTGACATGTCTTATTAGACTTGTA
CCCTTCGGCAATTTCTTCGCGCACTGTAGTTGTAGCTTGCACTCCGATCGTCTGATCGCATTGTTGACATAACTCGTGCATTTTTTCTCCTGAACTTTGG
ACCATAGTCAGGCCTTcttgacaatgcatcagctaAGATGTTCGTCTTGCCTGGCTTGTAGTATACAGCAAAGTTATACTccgcaaagaaaaaaattcat
TGAGCTATTTTTTGCGATAAATGATAAGTCTATACTGCTGTTAGAATcgaggcatgatctgtataaatCGCAAAGCGTTCATCTACAAGCAAGTACACAC
GGAAATTAAActaagcatacttcattgctagaagatctttgtcatgaactggatagTTCCGTTTCGCAGGCCGGAGATATTGCGGCTCATACGAAACAAC
TCGCTCTCGACCCTCATtatcgtgttgcatcaacgcacaaccgatggcaaagtcactCACATCGCAGACCACATGAAAAAGCTTATCGTGGTTTGCAAGG
AGCTTCTCTCAGGCTCTctttcacttcggcaaactTCGGCAAATTTTGACCATTCCCACTCAAAGttcttctttaaaagaaTCGTTAGGGGTTGAACCAA
CACTGCATTATTGCgcgtgtatttgtgcaaataatTGGCCAAGCCCAACCATTGTCTCAGCTTGTTCACATTGCTTGGCACAGGCCAATCATTGATTGTA
TTGACTTTCTCCGGATCTAAACGAATGACATTCTTGCCCACAAAGCAGCCGAGAACGGGGATCTCTGTTGCAAAGAAAGTTCAAAATTTCAGATTAGCGT
AGTTTATTCCCTCGCATAACTTGGAAGACCTGGCGAAAATGATCAAGGTGAACATCGACATAAGACTTCTCATCGGTTTTTTTATGAATGAGTATATCAT
CAAAGAAACTCGGCGCAAACTGTCTCAATGGAAGAAGGAAAGTTGTTACCATTTTGTTGAAAGTTGCGGAAACGCTCTTCAAATCTTGTTGCATCGATAA
CCATTTccacagcataccactgAGGGTACTGACTGCAGTTATTGGTGTATCACTTTTGCACATTCGTATCTGATAAAACCCATATTTTAGATCGAACGCA
CAGAGAATAGAAGTACCAACCATTCCATCAAGTATCATATCCTCGCATGAAACCGGAGTCTGGAAAGGTCTGGTTGCATCGCTTAATTTATtgaaagcgt
gaacaatgcgCCAACCTCCTGTGGCTTTCTTCACACAGAAGGTTGGACTACAACGCGAAGACTTATCCTCACACACATGACCAGCCTTCTGTTGCTGCGC
AAAGAACTCGTCAAAGGCGATGACTTGTTCTTTTGGCAACGGCCAATGCCGTGTAATACAATACTTCGTACCAGGAAGCATGTCAATCACATTTTTAATG
CCTCTGTCAGATGGCATTTCTCCGGGCATCTTGTCTAGGAATAATCGGCATATTCCTTGACAAGTCCACACACGGAGTTCGAGTTTAGAGCGTCTCATGA
CTGCTCGTTTCCTTTCGTGTCTTCTCATCAAATACTTCCGCAGTATTGATGTCATCGTCCAT