Description :
From Genome Similarity Track
Location :
contig_31:76553- 78639
Transcript NameFunction/comments
g6048.t1hypothetical protein
g6049.t1hypothetical protein PHYSODRAFT_319148

Sequence
2086 bases(100 bases per row)
GCCGGGCTTGGATTGCACAATCCAAGCAAAACACGCCACTCATCCTCGGTGATAAACTGCGGTCGATCATCCGGAAGACTTTTCGTAGATTCAGGTTTCC
ATGAGTCAAAAGTCTCGTCACGTTTGTCCGACGGCTGATTGGAATTGCGAGAACGAACAAGAAGGAAAAAGACTGAAATGCCAAACCGCAGCACATTGTG
AGTCACCGGAGACTCGGCTGGATTCGTGTCTCGAAAAGACCGATCGGCTTCGCTCCTCGGCACAAGTCCCAGTCCATCCACAACACCTCTGCGCTCCGAA
TAACTGCAGAGGAATGTCGATGGCGACACATCATGGTACGCTAGTCCTCGATCATGCGCATACTGGAGACCACGAGCGCAATTCGCCGCATAACGCCACA
GATCCATCTCGTAGCTGGGCGAAAAGCAGGTCTCGTGGATGACGAAAGGTTTGCCAACGTGAGAGGCGCCGTAAAACTTGCGCAGGTGCGGGTGGTTGAG
CTCTGTCCAGATCGATGCCAGTCGAACACAAACTTCCTCGCTTATTTCTCCCCGAACCTGATCACTCGCATTTCCATCCGTGTATTTTGCTCGAGCTTTG
CTGTCCCAGGCCCCCTTGCTGTCCTCAACCTTGGCCTTGTTCACCCACGCCCACTCGTGATCGGAGGTGAAAAACCACTCGGGCGGCTTCCCTGACACCA
CGTTCGTCTTTCTCACAACCAGCTCATAGACCATCGCAAGCGTGTCCAGCTCGCCCTCCGTCAACTTGTCTCGGTATTTCTCGTCAGCACCAGCAAATGG
TGTCAGGCCGTCATGATACTTTTTGACACAGTAGCGCAGCAACGTGACGATTTCAAGTTGCTGGTTCTTGTTGCCGAAAGCAGCAAGTAGCTGCTCCTCG
TCTTTCACAAAGGCTTCGAAAACTTTCAGTCGCTCCTGGCGTTCTTGCAGGAGTTTGCTGTGCCAAACCTCTCGCTCCTCTTGGTCGAGAATGTTGAGCA
TATCCAGTGCATTGTCAATGTATTGGTGCAGCAGAGTAGTCACCCGACCCGTGTCCGCCAGCTTCAACAGCAAATTGGCTTGGCTCTCGTACGAGTCCAG
CAGCTCCTTCAAAATGCGAGTGAAGCGCACCATGATGGCCACCTCGCTTGTTTCGCCACGACATTCGTCGCGCAACTTGCCCACAAAGTGGTCGGCCAGG
CGGTCGTCGGTGATGAAGTCGCCCTCGTGCCTCGAGTGCCACCGACTGTCGTCCGGGATCTTGGAGTCCATCCAGAACTTGGTCATCGTCTTGCTCATGT
TCGTCGGCATGGCGACTGAAGACGCCGCCGCCCGTGGATCTGCGTCTTCTCCTGCAAATCAAAAGTGAGACTGGTTGGTAGTGGAGGCCCTCCGCTGGAG
GGTCGTCCCGTAGTTATCCTTGCAACCCACACGCCAGCCTCATTCAAAAACCAGGTACCCATCGACAACATTCTGTGGCCAGACGTCGCCAGAAAAGCCG
AGCGTTTGTGTAGTTTCTTAGCCCACGAAGGATACTCCGGTTTCATACACTTGAAGGAAAACACTGACAACATCATACTATGAACATGACTGCAGCGGTC
GAAAAGAGAACAGATCCATGAGCTCAAGTTGAGCTGTTCGACGATATGAAGGCGGCATTGATACACTTCAAAGTACTTCAGTATGCAGCAGCGCAACTGA
AATGTAAAACATCAAAGGGCAGAAAACCCTTACGAATTGATGGTAGAATGGTATGTTTTGAAGGTGAAAGTCAACAAAGCAAACTATACATATTGATACT
GAGGTATTGTCGGTCAGTCTACGCTCATTAGACCAGATTTACCAATAAAATTCCTCCACCGGACTGCCATCCGCGTCCAAGAGGCTAATCTTCAGGAACA
TGTCGCTCTTGGGTGCTCCCAGCCCGCCCACTTCGTCGGACAGCACCAGCGGGTAGCTGCACAGCTCGCAGTTTCTGTTTCCGGCGTACAGCGTCAACGG
AATCACCGCTGAGCCAATAAGGTCGTCCTCGGCGGTTCGGTTTTGGTCGAAGACCTGCGCAATGAGGAACTCGTTCTCCCACTCGT