Description :
From Genome Similarity Track
Location :
Scaffold_43:7654- 10066
Sequence
2412 bases(100 bases per row)
GTGTGTGCAGCTTTTCAGTACTGTACATGTTTAAGGATTAAGCCTTACAAGATTCATGCAGGTATTAATACATGCATAGGCAACCCGGAGCGTTGCTCCG
GGAGGGTACACAGGTCGGCGAATAGTTTCATGGACGATGATAACGGATAACAATTGAGTAAATCCCAAAGTTGTGTTGTTTTTAATCCTTTAACCCCCGC
ACTCGCGGATTTTAAAAGAGCACTACCAGCCGAACTCTCTAGTTGATTCTAACGTGGGCATATACTGCGCCTGCTTCGCAGCCGCAGCATCTGCCCGGGA
ATAACACCCTGGTCAGCGTCCAATGGCTGCGTTGACGCCAGCAACGAGAGAGCTATTTCATTCAGTTTGCAGGTAAGGTATACTGTGCTCATTTAGTACT
ATGTTGTGTGCTAACGATCAGTGTCACTGTCGAGTTGAGCTGGTTGGTTTGGCGAGAGACACGAGGTTGGGCATCTTCGGCTAAGTGATTGAGTATAGAG
CAAATTGACATGTGAAAAATGCAGCCTGCAGCTAGACAAGTCATATTGGCCATCTTCAGCTAAGCTTGGTCGAGTATGGCGCAAATTGATACGCCTTCAG
CGAGGCCATAGTGGATCCTACGTAAACCTTTAACCCTTCGCCGCAATCCCATCTGTTAAATAGCCAGCTCACAAAGATTTCACAGCACTTCGGGGGCCAC
CAGATCGCCTCACTTCGCAACTTGCTACCAAGTACAAGGTATCTGCCAACCAACAATGCGCCTGAGTCACGTCCTTTTGGGGGTCGCTGCTTCTTTCCTA
GCAACCTGTGGTGCCACGCCTGCGTCAACTCAGACCAAGCTCTCTCATGAGACCGCAGCGGACCATGTTCAGTCTGTGGAGATCGACAGCCCAAGCAAGC
GCTTGTCTGAGGACCACCGAGACGGCCGCCGCCGTGGAAAAAGACGAAGACAAAGACGAGGAGCGCGCCTTTCAGGTTCAGTTCCTCAACAAGCTGAATC
TCCCGACGTACTTCGGCAGCCCAGTCGGAAAAGATGGAACGTTTATCAAGACCTTCGTGAAGGCGCTGCTGAAGAACAAAAAACTCCGGAAGAGGACATT
CCAGGATTGGGCAACGGCAAACCTTGACGGCAACATCTTGAAGCAATCGCTCGGAGGCTGACCGACAAGTACCGAGTTCAGCTGTTCAACAGATACACTG
CGTTTACGGGAGAGCTCGTCCGTCGGCCAGGTAACGATTTGGTAGGCGAGGGATGGATGATTCTGGCTCGCGTTGTAGCTAAATAAAATAAGAAAGCGGT
AGCTTTCATCTAGCGACTTCTGCCATACCTTTCGCCTTTCGAGCGTTTTTTTATATTTCTCTTCAACCATTTCCCACTGCTGGTGCACTGTACATACTCT
TGATTAATTAATCAGAGTCTCTGATTCAGAGACAGCCTTTTCTGCTTCCATTACAAAATTTGTGAAGTTAATTGGCGAGCTCCACGCGCCACTTATCGGT
AAAGAAATTTGCTGGCATGTACTATAGGACTGCTTTCACAGCATCAGCACTGATCACGGTGCATGTATTGCTGCAAAGCTCACCTGCAGTAGTCGACTGT
GAGAGGCCCTACTTGCCAAGGTACTTTAAACGCTGAGTAGACGAGCGATGCGTCCGAGTAATGTCCTACTGGTGGTGGTCGCCGCTCTTGCTGCAAGCTG
CAATTCCTTCTCGGCGGCAACAACCGAGTCGACCCAGAACAACTTAACCCCCCCCCCCCCCCCGTTCGAGACGATTGAAAACCTAAGGGCAATGGTCATG
GATGCCACCGACGCTGAGGAGAGTAGGAGGCTCCAGCAACTTGCCTGTCACCGTTGTGGAGGGCCTACTGATGAATGAGAGCCATCGAATAACCTACTTC
CGAGAGGCCAAGCTCAGCGGGGCAGGCCTCGTTGCTCGACGACCTGCTGGACCGCAGCATGATGGAGCAAGCTGCCGTGTTGAGGTACCGTACATACCAA
ATCCAGCGCTTAGCGTGAAAGAGAGGAGGGAGTAGAAGTGTTATGCGTTGCTGTGTTCGTATCGATATCGTATTACGGGGATAAGAGTCGTATTTTGCGT
CATGATGAGGTTCTCGCCGCGCGACTGAACAGAGAGATAGAACGGTAACTCTCCATCCACAGCACGTGCCTGCATGGGGGCTTGCAAGGTGACGAAATTG
GTCCCCGCAGGTCGGTTGATGTGTTGATGTTGGGCGTGTCGAGAGTTTCTTTACAATAGAATCGATACACTGTAGTGACGACCACAAGGTTGAGTCGATC
AAATCGTTAGGAAACGACGCAGCTGGTGGCTCAACCGTGGCTGCTGCGACGAGCGCCACGATGTTCACGATCCCGGATCGTTTACTTTCCTGCGTGCACC
GCGCTCGTGCAT