Description :
From Genome Similarity Track
Location :
Scaffold_1087:7654- 8937
Sequence
1283 bases(100 bases per row)
TATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTGAAACATGGGGACTCTACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGT
GCGATTACTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCTATACACGAGAGGACAGTATAGTGAAATCAAGACAAACCGGAGAAGGGTAGGCCGG
TGCTCCGTGTCCTCCATTTATTGGCTCGGCTTTCCTATATGAACGCTCCGGGTCTTCTCCGAGGTGAGTGTCCTCCCATTTTTGGCTCGGGTTTCCTATA
TGAAAACTCCGCGACCATTTTCGGTCAATTTATCATGTTCGGGGGCCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATA
AACCTCGACAGCACAGCTTCCTAGCCAATCAGGAGATAGAAAAACTACCATCGTCAGGAGTAGCTGAAAACTTGGGAATCCGTGTTTATACATATGGCGA
ATTGAATGCACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTACTTTTTACACACTTCTTTAATAGTAACGTTAGAGCATTGAAAACGTAGGATTCTA
CGTTTCAACATGTGCGGAGTTCAATGGTACTACTATTTCTCAACGGACGAGCCGTTATGGACTTTCTTACAACTTCCTCAATATCAACGTTAGAGCTCTG
AAACATGGGGACTCTACGTTTCAGAATGTGCTCCGTTCCATGGTATTACTATCGTGCGATGACTACTCGACAAGGCGTTTGTATGGGGTAGAGGGTCCCT
ATACACGAGAGGACAGTATAGTGAAATCAAGACAAACCGGAGAAGGGTAGGCCGGTGCTCCGTGTCCTCCATTTATTGGCTCGGCTTTCCTATATGAACG
CTCCGGGTCTTCTCCGAGGTGAGTGTCCTCCCATTTTTGGCTCGGGTTTCCTATATGAAAACTCCGCGACCATTTTCGGTCAATTTATCATGTTCGGGGG
CCATACAAACTCGAAGTCATGCATAGAAATCCAAGTCATTCAGGGTTAGTGCATAAACCTCGACAGCACAGCTTCCTAGCCAATCAGGAGATAGAAAAAC
TACCATCGTCAGGAGTAGCTGAAAACTTGGGAATCCGTGTTTATACATATGGCGAATTGAATGCACCGACTCGCGTGTGTCAAAGACTTGCCTCTCTGTA
CTTTTTACACACTTCTTTAATAGTAACGTTAGAGCATTGAAAACGTAGGATTCTACGTTTCAACATGTGCGGAGTTCAATGGT