Description :
From Genome Similarity Track
Location :
Scaffold_24:7653- 8843
Sequence
1190 bases(100 bases per row)
AGCATAAAAAGCACACCAGGTCGCGCCGACCTGAAGTTGTGCTCGGCATTCAATGCCACATCCACCGCCTCTTCAAAAGAGTTAGGGTGTACACGGAACA
CTTCCGTTCGAGCTGCGCTCACACGAAGTCCCTCCATGAACACGGTCACGCTGACCAGTTCCGGAAGAGGGTCCGCCGCCATTCCGGCGATAAGAGTCTC
AACTCTTGGACATAGTCCAATAAATCCTTCTTACCCTGGCGGGTAGCAAGGAACTTTGACCGGATACGGTACGCCTGATTAGGCGGCGCGAACACGCGCG
AAAGCTGTTGCTTCAGCTTATCCCAAGTGAGAAATGCAGCGTCAAAAGACGTGCCGCACGTTAGTGCCCATTCGCGAGCGCGACCTCCAAGCCTGGAGAT
AGCCAGCGCCACGCGCTGATGCTCAGACTGGAGCAGGGCCGATCCCATGGCCATCTCGACCTCACGGGTCCAGAGAAGGAGATTCTCTCCATCCTTCCCC
TCGAAGGTTTCTACGCTCACCATGAGCGGTTTCAGTCTCATAGACTCTTCACGCGTCATCGACGCCGCCGCCGTTGCGGCGCTCATCTTCTCTTGGACAT
GCCCCAAGAGCGCGCTCTCGTAGCGGGAGAACGATTCCAGCCTGGCAGTGACCGCCTCTGGACCTTGTGATGCAAGATGAGCCACGCCCTCCGGGCCAAG
CAAGGACATAAGCTTAGTAAGCGCGTCCTGCTGCGCCGGGGGCAAATTCGCGAACACGGGGTGTTCCATCCTCGCAGAGGATATAGTCAACCGACTCAGG
AGCGGGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTAAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACCAATACTAAGTTCC
TTATCCAAAGGACACTTACAGCCCAAGACCAGGGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGAAGTGTTTTATTTACTATTATTGCGGC
CAAGCCGCCTAGGGGTAAATGTATCTCCTTAACTATCTAGCATAGTTAAACCTAATCAAATGCATAACGTGTGGCTTTCAGCCAACGTACTGAGAGACCT
TGTTAACTCTCCAACTTATGTACTGAGAGTTTGTTAACTCTCCGGGTACTTCGTACCCCTGTGTGCTCCACACCATGTAACCCCGTTACA