Description :
From Genome Similarity Track
Location :
Scaffold_448:7652- 9030
Sequence
1378 bases(100 bases per row)
AGCTGTTCCACAACTTGCATCTCTGCTTCTTCGCCTTCAGAGCTGAGCTCCATGGAATGTGGCCTATCGAGCTACCCGTCTCATACCAATGGGAACCGTA
ACGAGGTGATTTGAAGTTTAAATTAGCGTTCAACGGCATGTCCGCCATCTCCTCAATGTCGACGGGTGGACCCAAAATTCTTCCTTCCTAGAAATTCTAG
TACGGATTCCTTCCCCAAAGATGGTTTATCAGACTTCCTCTGGAAGAGGATCCAGTTTCATAGCTGTAAAAAGAGTTTGCAACTCCTGAACACAGTCCTA
TAATTATTTTCCACTCTGGCGGGCAGCTAAAAATCATGATCGTACACTATATGCCTGATTAGGCGGTGCGAACACTCAATCCATTTGTCTCTTAAGCTAA
TCCCACATGGGCTTGCGCGGAGTCTACAGACACATCACGCGTTAGTGCCCATTCTCTAGCTCTGCGCCTTGTTTGGAAATATCCATGCCAACTCGTTGTT
GCTCGGACTTGAGCATAGCAGCTCTCATCACTATATCTACTTTTAGGAATACAGAGTAGGATGTTTCCCCCCTCTTTTCCCTAGAAAGTCTTAGCATCTA
GATCGAGTGGGTGAGCCTTAGGCTCATCTTCATCTATTTGTACATCGATGGCATAGCCGATGCTACGTAGTCATGGACCTGACCAATTAATGTGTCTTTA
GGGTTTAAAAAGGCGTCCAGACGCGTGTTTAGCACGTCCGAACCCTGCCCCACAACAAGGCTCAATTGCTCGGCACCTATCAAAGCGAAAAGATTATCAA
GAGCCAAGCGTTGAGTATCAGAGAGGTGAGCAAGATACCTTATTTAAAAAAGTATCAGTCTTATAGACTCAGGTGTAGGTTTGACTCTAGTGCAGCCAAG
TTTAGCGGGGCATATATATCCCTTGGTCAAAGGAAGACTTTGGCTCTAGCCACTTAGTTCTAAAGAACTAATAACAACGAGTTATGATTATACCCTTTCT
AAAGAAGTAGGTGAGACTGTACATTCAGCAACCTTAAAGCTTAACAGTTTCAAGAGAACTAACAAAACAAATAATCAGGAGTATGAAGTCTATAAAGACT
TTTACTCCTCTTCTCAAAAGACAAACTGAACATCATTTATGACTTATCTGCGGTAATAAAAAAAATTCAAAGTACCCTACCCTAAGGTAAACTGCACCAT
ATTAGTATGCCGAATAATTTAATGAGTAACATGTCAGTCACTCATCAAAGTATATTTGACGTAATTGGTACTTTCTGTAATCGTTCTAGAACCTTAACCG
ATAAGGTACGATATTACTGATATTACTTTAAACGGTTCAAACCCAATATGTCTCTATATACATCACCAACTTATAGGA