Description :
From Genome Similarity Track
Location :
Scaffold_3:765131- 766472
Transcript NameFunction/comments
Phypa_INRA-310PPTG_01404hypothetical protein
Phypa_INRA-310PPTG_01405hypothetical protein

Sequence
1341 bases(100 bases per row)
GATTTTCAGGAGCTGATGAAGTCTTGGAATCATCACACACGCGCTGATGGAGAGAATAATCCGGAAGTTGTATATTCAAAGTGGCTTGAGTGGTGTTTGG
TATGGCTGTTACAGTCATCGTGCACATCTACGGCATTGCAGTTTCTTAACGACGAGGAATCTTTAAACACGGCAAGCCACGAAGCATTCGTTGCGAAGAC
AAGTCCATACCCATTTCTCCAGCAGTGGTTGCTCTACTTAAGTCGAATGGGAGTTGCCTTTATAGAGATTTCACTTACTCAAAAAGTGAGTTCGGACTGG
GAAATGCTCCAAGTGCCGGGTCAGACTGCAGTATCGTGGACGCAACAGAAGGTGCCAAGTCGTCAACAGCTTTTTATGGTACTTGCTGAGCAAGACGATA
TGATGGTCGAAGTGCTGAATGGTCTCACACGGATGGCTGTGCTTGTGGATGGCACCGACAGTATCCTTACTTCATTGTTCTCGTCATTTATCGAGCATAT
GACTACCGAGTATGACCCGGACTTACTGTTTGCCGATTTGGTGGACACTCTTGGACAGGATCATTTGGTACTTCTAGACCTTCTCATTTCAAACGGTAAG
TCGTGAGTTGCTATGTACCGCTGAGTTCTTACCCGTGTTCCTGTTGCAGAAACACAAATGCTGGAGTACTTGATGCGATATTTGCGGCGTCTTAGCACTC
ATTGGAACACCAGCCAGCGAAAGCTGCAGACCGAACAGAGACTTGAAGGCGTGATGAGCGTACTCATCCGATTGCGCCTGGAAATCGATCGACTTGTGGC
TGCAGACCTTTTCCCTTACAGTGCAGGACCACTGACAAGGCGATTGCTGGCTGTCGAACAACTCTACGAAGAATCGGATGATGAGGATGCAGAGCAATTA
TAAATTATTTGTTGTTAGAGAATTTCTGCGCGGCTTCGCCAAAGCTCAGCATGTGACGAGTTTACATGCAACAAATGCAAAAAATACTGGAAACGGACGA
TAATAGAGCAATGCACACAGCGGGTGCAGGAGCCGTACGAAAGTAGCCCTCAGGCAAACCTGGAACGAAATACCGACTTAGTGTGCCGAGTCTTCAATCC
GAATACCGTGCGAGCGGCGATTGAGCTTGGCTTCCAGTTGGTCCTCCATGTAGTGGAATTGCTGGACCATCGAAGGCAGCAGAGGCTCTGCGATGATATT
AAGCCAATCACAATCACGTGAGTGCGCCAGATACTTCATCCAGCAATGCACCGTATCCGAAAACCTACCGAGCTCTTGCTTTTGGCTGCGCAAGATTGCC
GAGTTCACCTCGTCCGCCACACGGCGACGTTGAGCCTGCTC