Description :
From Genome Similarity Track
Location :
Scaffold_66:76508- 80507
Transcript NameFunction/comments
Physo_157877ubiquitin-activating enzyme E1 family protein
Physo_119674hypothetical protein
Physo_138701hypothetical protein
Physo_138702hypothetical protein

Sequence
3999 bases(100 bases per row)
AGAAGCGCACATGCCAGCTCCACATTTCCATTGTCTACGGACTGGTGCAGCGCAGTGTTGCCGTAGCGGTCAATCCGTAGACTCGATGTATTCAGCTGGC
GCCAAGAGAAGTTACCGCCGTCGCTTACTCCTCCACCGTAGTGCGAGAGTGCATCGGAGTGTGACGAGGCTCTGGTGGTGATCAAAGTCATAGAGTCGCT
AGACACTGGATCTATATCTCGTCCGGCAAAGTGTGACAGAGCAGCTTCAGCAGCTTCTGCTCTGCGACGAAGTCTCTCGACCTCTCTCAAGGCCTTCTTC
AGCATTGCGTTGTCACTGTCGGATTCACCCCCAAAGTCACTCATTCGCCCACGAAGCATAGCTCGTCGCATGACATCCATAGGTGAAAAGTCCACATCCT
CCGAATACGCGCTTGTTCCGACTGATGCAGTGGCAGTTGAAAGTACGTCGTCTTCCTCTAGAGTCTCAATGGTTAGTTCACTGCCACGACCGCTATACCC
CGACGGGTCTGTCGATTTGTCTTCTTGGGGAACTTTGGCGGCGGCAGATTCAGCTGCAGCTGCTCTCAACGCAACACGGGCCTGGTGCCATCTCCGGAAT
ACACGCTGGATAAGTAATGCGCTCTCACACCGTTGTTTTTTGAGAGCCAAAACCCAGTGCCGCAGTGAACGTTGAAGCAACCTTGCGGCCTTGTTTCGTC
GAGCAATTCGACGCTTCTTCTCAAGAATGGCTTTCCACCGCACTTGAATGCTCCACAATACTTGCAATTGTCTAATGTACACTCGGCGCTGTTGTCTTCC
TCGCCATGAACTTTGCAGTTTAACAGCTGAAGCCATGACAACCCGTTCACGTCGCTTTTCCAGTTGATCAAAGGCTTGCTGGCGCAAAAATACACGCGTT
TTACCGAGCTCTGTATGGTCGATCTTGAGTGTTTCAAGAAGATTTGACGCAGTCAACTCTGACTGCTTCTTAGCAGCCACCAAAAGTTGGTATTGCTTCA
CAAAATCGGCATGGAGCATACGAACTGGATAAGACTGCCGCATAATCTCCACAGCTTTCAGCACACCACCATAGCGCAACTGGCTCGACACCTTAGCCAT
GTCAAACTTATCGCCCGCGCTCTCGTCGTTCGGCTTGATACAGCGGATATAATGCGTTTGTGTTTGCTGCACCACATCGAGCAAACTTGCAAGCTGCTGC
TTAAACTGAGAGCCGATACCAATCGAACTGAGCACTGAGGATCGACGCCTTAGCTTAGGCTGGCCCAGTTGTAGTTGCGCCGACTCGCTGGCTTTGAAGA
AATCAAACAGTTCGCGCAAGTGAGCGTCGCTCGTTTTCCCCAACACACTAAACAGCTCTGCGTTGGGCTGATCTTTGTTCTTTTCGCAAAAACCTTCGGC
CTGATATCGGACGTTTCCTGCATAGTGATGAACTTGAAAGGCAAAATCAGCCTGATCAGTCCGCGACGCGCTGAAATAGCTATGTTCTTGCAGTCGCTGA
TACAGTTTCCGCGCAAACCCTGCGTCGCTCCCTTTCGGCACTACGCATTCCTCGTCCAGGAGCGAGAAAATACCACTAGGACGTTGTTCAACCATCTCCA
GACACAGAGAATTGTCTTCGTAGTCCACGGCATTCCACTTGATCCCTTCCTCGATATGAGCTTGCTGTTCTGTCAAAAGAATGTCTTGGATGAACTGGTA
TTGCAATTTTTCATTGGCATAATTGATGCAGAATTGTTCGAACTGGTTGATCTCGAACTCTTCGAATCCGAAGATATCCAGCACTGAAATACACGGTGCC
GCATCCTTAGCGACGCCCTTGTTGGCAGGATTTGTAGAATGTTGAATCTGCGGCGAGGCTGAATTCACTTTTGACACGAGGAACTGGAACAGAAATGCGT
ATAAGGAGCGAGCCATAGCATCTCGAGCGTCTCCACACTGAGCCAGACTTAAGTTGGCATGGAAGGTTTCACCGCCGACGCTGATCTTGCGGGTAGTTAA
CGCTGGGATCAGTTCATCTTGATCAACAGCAAACAGTATTGAAACGATATCAAGATGTTGCTGCACCGTAAGCGAAGAAGGAGATGCAGTAGCCAACTGA
CACGGCGCCGATGCTGTTCCACTATCTTCCTCCCCTTCGTCCTCACTTGACGAAACAAACAACACGTTCCCAAGGTGCAACAATGCGCTCAAGATTTTCC
AGATTGCCGCTTGCTCAACATCCGTAAATCCCAGGACTTTCATCGACTGCAAGACTAGCTGGAACTGCTTGTCGTCACGGACCCCGTCATTCCTCTGGAA
GCATTGCCCACCACTGATGTACTGGAATTCCTCAGCTGAAAGATCCTCCAAATGTAGCTCGTTCTTCATATCGTCATCTGCCCCAGCTAACAGTTCGTAA
AACACATGGAAATTCCTTTCTCCATCGTTCTGGTGCACCACGCGCACTTTTTCCAGCAAGTACGTCTCCACAGACGTCCCCACCATCCGCAGCGACTCAT
CCAGCTCGTGCCCTTCAAAGAACATGCGCACAAACTTGCCAAAGCGACTGCTATTGTCGTTGCGCAGCGTCCTGGCGTTTCCAAAGCACTCGAGAATGGG
GTTCGCGCTCATGAGTTCGCTGCCGCTGATGGCGCGTCTCCTCTTGCTGCTGCTGCCTGCAATAGCCGCGCTGCGACTGCTCTCCGCTAAGTAATTCATA
ATGAACTTGGTCGTCTCCGTCTTGCCGGCGCCGCTCTCTCCACTCACGAGAATCGTCTGGTTCTTCTTGCTCTCCCCGGGCTCGTGCAGTCTGCGTCGCA
GCGACCTGTACGCGCCCTCGGCAATGGAGAACACGTGCGGCGGCAGTGCCGACCAGCCGGGCATGTCGCTGTGGAACTTGTGCAGGTCGTAGAGCCCCTG
GATCTCCTTGAACGGGTTCACCGCGATGAGCACGGCGCCCGACCTGCAGTACACCTGGTCCACGCCGTAGCGCTGCGCCAAGTAGTCCACGAAGGCCGGG
CTCGTGCAGGTGCGTGAGCGCGTCCAGGTTCTCCACGTCCGCGAGCGTCTGGCCGGCCGGCAGCTCGTTGGCCATGCGCACGTCGCGCGCTTCGTCGGCT
TCCACCGCTTCGTCGCAGTCATTCAGCTGCACCAAGACGCGGGCGGCGTCGCTCTCGAGGCGGCGCAGCACGCGGCCGCGCGCCCACTCGTACTCGGCCT
CGGCGGCCCGCACGCGCACGTACACCTGCATGGGGGCGGCGCTGGGTAGAGCGGAAGTGGGTGTTCTCCAGCTTCTTCCTCCCCTGGCTGCGCTCTTCTA
CTTCTACGAGAGCTCAACGCGCTGTCGCAGAACGCGCGCTGATTGGTCCAAATCGACATCTGAGTCAGTATCCGTCTACCGCACCAGCTCAGCAAGGCGT
AGGATATGTCGCTCGTATACCTGCCCGAGAGCGCGTGGTCGATGCGCTACGGTGCGTGCGGCATTGTCGTGCAGTGTGGATTGAGTGCACTGGTTAATAG
TCGTGCGGTGGGTGGTTTTCAGGGCCGGATTACTTCACGGTGGCCATCGTAAAGTACCTCGTCAAGGAGGACGAGTTCGCGCTCTACGAGCTGCAGATCC
AGAACGGAAGACGCAATTGGAAGGTGCTGCGTCGCTTCAGCGAGTTCGACAGGCTGCAAGCGAGGTAGGAGGCTGCCAGGGAGTATTGACCGCGTTGTGA
CAAGGAGAGCTGACACCTCGCTGTCCAGTGTGCGCTTCAAAGCAGGTGACCGACTACCAGAGCTGCCGCCCAAGACGTATTGCTGCAGGGACCTGAACCC
GGACTTTTTGGCCAGACGCAAGGAGCTGCTGCAGGTCTTTCTGCACCACATGCTGCAGATCCCCGGTATCGCTGACGACGACCACGTGCGCGAGTTCCTG
GGCCTCAAACTGTCCACGGAGCTCTACGTTTGAGCCTAAAAGTCCATACGCTAGCTAGACACGCCATGCTTTCATCAAAAAGTGTGTGCGCCCACTGCA