Description :
From Genome Similarity Track
Location :
Scaffold_25:76506- 85857
Transcript NameFunction/comments
Phypl_g1057hypothetical protein
Phypl_g1058hypothetical protein PHYSODRAFT_493289
Phypl_g1059hypothetical protein PHYSODRAFT_369743
Phypl_g1060hypothetical protein PHYSODRAFT_388544
Phypl_g1061ABC transporter ABCF family

Sequence
9351 bases(100 bases per row)
ACCTGCACAGCGAGAGAGCAAGTCAGTACACAGCCTGGTAAGGTCACAGACacagcaggagctccagctccgtaCTCATGGCGTCTCTTGCAGCAGTGGG
GCGCGGCGTCCAAGTGTTGAAGTAACGGTccaggagtgatggtctaTTTGACGTGGTGCACATATCCACACGAGATCTTCCTCGTCACACACTTTCACCA
GCGCGCAACGCGGAGAACGGAAGGGGAAGATGCGCGCGAACGAGGACAAGATCGCGCAgttgctggacaaggtgcgCGCTATCTGCCTCCTGTCTGCAGC
GGAGGcttgtgctggtgctgacaCTTGCGTGTATGCGCGCAGACCACGGACTTTGACAAGGATGAGCGCTACATGGCCACGTCGGATCTGTGCGTCGAGC
TCAACAAGGACATCGACCTGGGGCCGTATCTCGAGCCAAAGTACGTAGCTAGCGCCACTATTTGAGGGAGCGTCACTCACCCTCGGTGTCTGCCGCGCTG
CAGAGTGTGTGCGGcggtgctgaagcagctggacgacaagtCGAACGACGTGCAGTCCATCGCCGTCAAGTGTCTGGGCATCCTGGTCACGAAGGTGCAG
GTGACCCAGGTGGCGGACATCTGCGCCAAGCTCTGCGACCTCATCCTCAACGGCAAGCCGGAGCTCCGGGACATCTACTCGATCGGACTCAAGACCATCG
TGGCGGACGTGTCCCAGACCACGGGGGCCTCCGTTGCCACCGGCATCTGCACGCGGCTACTGACGGGTCTGGGCAAGGATAAGGACGCGGCTGTGAAGGC
CGAGACGCTCGACATCCTCACGGACCTGTTGCGTCGCTTTGGCTACGACGTCGCCACGGAGCACGCGACGatcatggagctgctgatggtccagctcacg
gacgagTCGCCGCTTGTGCGCAAGCGTGCCACGGCTTGCGTAGGATCGCTGGGCGTCATGGCGTCCGATGTGCTGGTGAGCCGCTTGGTGGAGCACCTGA
TCAAGGGCATTCAGGGATCGACGGAATCGTCCAACGTGCGCACGCTCATCCAGACGATTGGAATGCTCTCGCGCACGGCAGGCCACCGCCTTGGACAACA
CTTGAACGCGGTGATCCGCATCCTGGTGCAATTCTGCGGGGATCCCGAGGACGAATCGCTGCAAAACGAAGACTCAGATGAGCTGCGTGGAAACTGCTTC
CAGGCGTTCGAGGCGTTCGTGATCCGATGCCACAACGAGATCACACCTCACGTGGAGGTTATTCTGAAGCTTGTGATGCAGTTTATTTCCTACGATCCCA
ATTACAACTATGTGGACTCTGccgatgaagatgaagacatggaggaggaagaggaggagtacagtgatgaagaaggcgactacagtgacgacgacgacac
gagCTGGAAGGTTCGTCGGGCTAGTCTTCGTGTTCTGACGGCAATCATCACAACGAGGCCCGAGCTTTTGGAGCATCTATACATCCATTGCGCTCAGCCC
TtgatctcgcgcttcaaAGAGCGAGAAGAGAACGTTCGCATCGACGTATTTGGGGTATTTGCagaacttcttcgtgctACTCGCAAGACTCTCCCGAGCT
CAAATGGAACTGGTTCCTTCCACCCACCCACGTCGAATGCGTGCGTTACCCAATTGGAGCAACGTCTGAACGCTATCGTTGTTGGGGCCAACAAGCAGTT
CGGAACGAAGGCTTCTGTTCCGTCGCGCTGTGCTGTGGTTGCAATGCTGAGTGAGCTTGCAACGGTGGAGCATGGAAAGTTGGGAGATTACATTGGTCGT
TTAATGCCGAACATTCTCAATGCGGTGGAGGACAAGCACTCCgacttgaagctggaagcgcttCTGTTCCTTCGACTGCTTGTGGATACGCACACGGTGG
AGCCATTCCGACCGCATATTGAATCGGTCGTCAAGGTTGCCGTCCAGTGCGCGAAGGGAGATTGGTACAAAACGGTGGCAAAGGCGCTTGGATTGATCGA
ATCGCTTGTCCGCATTATCCGCTCGGATGATGGAGATTCAACGTACAAGCCGTACGCGGTGCCCTTTTTCGAAGCGGTGCTGCCTAGCTTGAAGGTTCAT
GACATCGATCAAGAAATTAAGGAGGCTGCAATCAGCAATATCGGAGAAATTGTTGCTGTGCTGGGTACGTCGTACACTTGTGCTCAGTATACCGTTGATG
ATGCGTAGTATGGCTAACGAACGGTGTGTTGTGACTGTAGGCGACGAGCTTGGTGCACGTGCCGGAGAAATTTACCCACTGCTCATGGAGCGTCTCAACA
ACGAAATCACACGCGTTCAAAGTATCAAGGCCATTGGAGTCATTGCTCGCTCGAAGCTCAACTTGGACATGTCCCCCATTCTAGTGGAGTGCACACGAAC
GCTAGCCCAGCTGCTTCGTCAACAGTCCCGCACATTGAAGCAAGCGACGTTGGCCACCCTGAATGATCTGGTCGTCCACAAGGGTGCTAACATGCCGGAG
ACGTTACATTGCGAAGTGGTCATGGAAGCTtcccttcttcttgttgacGTGGACCTACAGCTGTGCCGCATGAGCATCACACTGGTGTCAAACTCGCTTC
GAGTATGCCCGCATGTTGCCTCAACGGATGCTCTACTGCAAAATGCTCAAGTGAAGGCACTGGAACTGTGCCATAGCTCCATGCTTCAGGGCCCGACTTT
AGATGCGCTGAAGGGCCTTTTCGCGCAGCTGACGCACTTGAACTCTccaggcagcagcttcaccgaGTTGTTCAAGGCGTTAATGGCTACGCCTACTGAA
GAGTCAAAGCACTCTGTGCTGAATATTGCTCGATGCGTTGCTGGTACATGTGTGGCTACGACGGAAGAAAATCGCAAGCTGGCTTTTGCGAAGTTCGTTG
GTGACATTACCCAAACAGAGTCTGAAAAGAACAAAGTTTTGGCGCTTTACTGCTTGGGCGAATTCGGCCGCAAGATCAAGCTTGCTGGCTATACTGATGT
GAAAGAGCTCATTCTGAAGTGCTTCAACAATGCGGGCGAAGAAGTGAAGGCGGCAGCTGCGTACTCGCTTGGCAGTATTTGCGTCGGCAACATGGAAGAG
TTTCTGGACACAATCATGGTCAAGTTGGAGCTTGGAGAAAACTCGTACCTGCTTTTGACGTCGCTGCGCGAAGTCATCTCGGATCATGCAGCAAAACCCC
ACCATGGTTTCGCTATGTATGTGGACCGTGTCCTTCCGGTTCTTCAGAAAATGAGTGCTCGCCAGGAAGAGGGCGTGCGAAACATGGTTGGCGAGTGCAT
GGGAAAGCTCGCTGTGACGGACAGCGCGAAGATCATGCCGATTGTGACGGAACTGTGCGGATCTTCAGACGTATGGTCGCGTTGGACTGCCGTGACGAGT
CTCAAGTACGCGATGACGACCACGGCCCAGGAGCCAGCAGTAAACGCGATCTTCGCTCATATTGACCCCTTCTTAGCTGCGCTTGAAGACGAGGACCTCC
ACGTTCGTCGTGCTGCcctgctcgtgctcaacACGGCtgctcaccaccacgcgcacTATCTGGTGCCGTACGTTCGCGAACGCATCTTCCCCACGCTTCT
GAAGGCGACTGAAATTAAGTTGGAGCGTGTGGTGGACCTTGGTCCGTTCAAGCACAAGGTGGATGATGGTCTTCCACTTCGCAAGGCTGCGTACTCGTGT
GTGGATACTTTGATCCAggtgctgccgcagcagctcgataTTAGCCTGTTCTTCGACCAGCTGAAGCGAGGCCTCGGAGACCAGGACGATATCCAGTTGC
TCAGCCACCAGATCTTGATTAAGATATGCTACGTGCAGCCTGGTAGTATTGTCGGTGCTTTGGATTCGTTGGTTGAGCCGCTAGAGAAGACGATCAACAA
GAAGGTGAAAGAAGACCAGGTCGGCCCCGAGGTCGAGCGCGTCAAAGACCTCATTCGTAGTGCGTTGCGTGCGCTAGATGCGATCAGCGCTGTTCGTGAC
GCAGACTCCCACCCGAGGCTGAATGCCGTGATGGAGAacgcgaagaagaacaagatgCTTGGCCCGCTGCTGGAAACCATTCGAAGTGAGCGTACGAGTA
GCTGAGTTGAAGCCTTGAGCGCGGAAACAGAGTATATTTCATCCACGGGATGGAATAGTGCGTGGGTTGACTCCAGCGATACGCTCAGGTTAACATTTGA
TTCTAATGGTGCTCGCTCACAATTTACAGCTCGTCGTTCGAACGCTTTTCAGTTGTCTTGGAATGTATAGCTTTTGCGGTTTGGCTGGGCTTTCGGTGTG
GGTGTTTCCTTTTCGCGTGTGAGTCTTTGCCCAGCTTCGTGCCTTTAGTGCGTGACCCCTTTGCTTTATTctgatggagctgcttgggTCCCTTCTtgtg
gcgatggaggcgatGGCCACGCTTCGAGTATGAATTACCATTCCACTCGTACTCGTTCACATCGCTCTGCTCGTCGAGAAACGCCATGACATCATCGACG
AAGATCCCCTTTTGCAGCCCAACGAGTAGTTTCGAGTCGGCGACTTCGTAGATGTTCACCTCCGCCCCACCATTCCACAGCATCTGTAACAACGTCCAAG
TACAAAATGGTAAGTGGCTGCGTTGTTGCTCCTGGTATCCTACATCAACGCTCACCTCTTTCCATCGTGATGCAACATCAGGAAGGGGCTCACTGTGTCC
GTCCTTCATCGTCACGAATATCATCTGGGGTCCAAGCGCCTttgcctcctcctcgttccTGAAGATGGCAGGGGGGTGAGTATTCCTAGCGTTCGCTGCC
TTTTGCTTATGTATGCTGCACTCACTTGTCCGCAAGTTGTCGATAGTGTTCGTCTCCCTccgtgcgcagctcctgctggtcgtcCCCAGCCTCCCACGCC
TTCTCCAGTGCCGCATAGTCGATCGTCTTCGACCGGCCACCTTCCAGGAGCGGTAGACTAGCTAGGAGTAGgctgagaagcagcaccagggGCCGCCACA
TCGGGACACAGAGCTTCGGGCTCGCGCTTGCTTGCGATACCTCTTCGTGAAGATTTCGTTGGCTGATCACCTCGTGGTTACATCCCGTGCGTCTATTTCC
GGTGCAATGCCTGCCTGGAAGTTGTAGCGGACAGCATGGGGCCATTCATCGTCCTTCATCGtggccaccagcttcagcaagaCCACAACACCAGGGCTCG
AGCTACAGAAGGAAACACAATACAGCGAAGATGAACTGCAGCCTCGGAGACCAGCTTCGTCAGCACGGCCAGAACAGCACCCTGCTGGACAATCCACCAG
ACAATCTGACTGCCAGTGGCAGCGCCCCAGTGAAGTGCTGCACCCAGGCCTGCTTCGTTCGCGAAGAGCAGAACGCGCGAGAACGTCAGGTGCGTAGTAG
TTGAGCCGCAGCTCCGAAAAGCTTGTGCAGTGCCTAACTTGGTTCCCGCCCACAGAAACTTCGTGACTCGTATGTTGCTTTGAAACTGGAGACGGACAAG
GAGATCGCATttctcaagcagcagcttgccgcgGTGTCTTCGGGCCACTCGACGTCCCCACAAACCACAATCGCTGGTTCCATAGCTccgccttcgtcgc
catATCAAGTCGCTACAGAAGCAACACCATCGTCACCGCACACTCTCGTTCCGACCGTGTACTCCATCACGGACTCCGGGGTAAAGCCATCCGGAAGAAT
CGATCGTTTGGGGAGTATTAAGTCGGCCCAAGTGCTGGCATCTCTACGACCCTTTCCAGTTCCAGCGACTGGAGGACTTGCCGTCGCGCGACGAATGCTT
GCAGCGCTAGCAGATCCCAAAATGTCGACGCAGCCTTACTTGCGTTCTCTTCAATTTGCAGCTGATCTGGTGGAGCTGAGTGCTCAGGTTGGTGCATTgc
tcgagcacgaagcaCGTTGTTTGGATCTACCCAGCCCGGTGTATGTGTTTGGCGACGTGCATGGCAACTGGACAgacttgcgcttcttcgcggaGCACAT
TTGGCCTCTCGGGCTGGAACTCACGGCGGGTAGCTTTCTCTTCCTTGGCGACTACGTAGACCGCGGCAGCTCGTCTCTAGAGTGCACGGCCTACCTCTTC
GCTCACAAACTTCTCTACCCGGGAAAGATCTTTTTGTTGCGAGGCAACCACGAAACGCGTGCTGTCAATGGCTTGGAGGCACACTACGGTTCCGGCTGTT
TACTTGCACAGTGCAAGACGCGCTTCGGTGCAAGTGAAGGTGCCGTGGTTTGGCATCAGCTTAACAACGCATTTGATCGTTTGCCAGTGGCTGCGGTCAT
CGACAACGATGTTTTCTGTGTGCATGGTGGAATTCCACGTCCGATcgaagacagcgaggacCTATTGGAATCAATCGCTAAACTGCAAACGGCGGCATCG
CTGGACACCTTGGACACTGCGTACTATGCCAACAAGCCGCAGTTGACCATGATCGCGGAAATGATCTGGGGCGACCCCGTTCGAAACGAGGAGGccctcg
agaagaacgaaCGGGCTAGTAACTGGAGATTGGACTCGCGAGGTTTCGGCAAGAGCCCACGCGGCGGCGTTGCGGTACGATTCGGGTCCAGAGCAATTGA
CAAGTTTCTTGGGCAATACGGCTTCTCGCGTATTTTACGAGCCCACGAGGCTGCACGAGAAGGACTGTCGTTCAGCAACTCGGCACGCGTGATCACCGTG
TTCTCTACATCCAAGGACCATGGTCTGGGCGACGATGCTAGCTGTGGCTGCGTTCTCGTGGATAACCAGCACTTGCGTTTCTTCAatcgagcaagaagcg
ccgGCAGAAATCATCGTCAGCAGTTGCTCCGGAGTCACAATGGTAGCAGCACGTCCTGGATCAGCCGTCTGTCCAGTGGGGTTTCGACGAGTAACTTTGC
TAGCATGCCGAGGTCACCACGACACCGAGAGCGAGGCGACCAGGACGGCGGCGGGGACGATacagacgacgaggacgaccaACCAAGCACCGGCAATTCA
GTTGTCCACTGCCCGATCGGTGCTCTGAGAATCAGCAACCTCGACCACGATGGACTCACTACTCACGAGTTTGATCAGAGTGGCGCAGACAGCCACGAGG
ACAACAACCAAGCTGACGATGACTAGCGAAAACCAATTGCTTGGACTGCTACGATAGGCAGTAAACCCCCAAAAGAATGGATGAAGCATTTCATCAAGAA
CCAAAGTGTGATTTTCCACTCAATGTGTTATCGATCGGCAAGGGAATCAAATATGAACAGAACGGCGCGCCGGAATCGGCCTTCACCAGAGCAgttctac
atgtagcaagCATCTAATGAGCGATCAAGATGGCGAGAGAACTTACTCGCCGGCAGGCTTGACGGGTTCCttctccgccagcttcagctgcttaCGCACG
CGCATCTTGAAGTCGGAAATCTCGCCCTGGTACACACGGATAGACTGATTCTCCACAAGCCAAATCTCCTTGGCGACCTGGGAAATCAATCGCATGTCGT
GACTGACCAGAAGCATGCCACCCTCGAAGTTGTTAATGGCGCGAGCCAGCGCATCGATAGACTCCATATCCAAGTGGTTCGTAGGttcatcaagcagcag
catgtgTGCGTTTTGCTGGGCCATGTATGCAAACACGACACGACTCTTCTGTCCGTCAGACAGCTGGCCCATGATCTGCGTCTGGACGTCACCGGTGATA
CCGTAACGGCCCAGGTAGCTGCGCACCTCCTCGACGGACTTGGTCTGGAAGAGCGAACGGAAGTACTCTAGTGGGGCCTTGGTCAGGTCCAGCACATCGA
CGAAGTGCTGGCTGAAACGGGCAATACGTAGCTTGCTGTGTGGTCGGACGTTGCCTGCAACAGGTACCAGGTCTCCCGTgatcatcttcagcagcgtggt
CTTGCCGGTACCGTTGGCTCCGACAAGGGCGACACGCGAGTCCAGGTCCAGACCCATCTCGACGCCAGAGTACAGCAGCGGGCAGTTCGGGTAACCGAAC
GACACGTTCTGAAACATAAGCACCGGGGGAGGCAGCGGCTCCGGGTTGGGGAACTTGAAGTCCCCGATGGACTCCTGCTCGACCTTTTCCGTAAGGCCAT
CACGCACCATCTTagccagcgtcttctccttaCTCTGGGCCTGACGGGCGAGCTTGGCGGAACCGTGACCGAACTTGGCAATGTACTCCTTCATGTGTTT
GATCTGTTCCTGCTCCCAGTTGTAACGCTTCATCtggttctcctccttctccgccttcGTACGCACGTACGTGTCGTAGTTACCAGCGTAGTACTCGAGC
TTTTTGTTGGTGAGGTCAATAATGTTCGTGCAGACCTCGTTCATGAACTCCTGCGAGTGCGAAATCATGAGCAGaatcttcttccacttcgacAGGTAGT
CCTCGAGCCAGACGACGGCCTCCATGTCCAAGTGGTTCGTCGgctcatcgagcagcagcagcgtcggctgGATGAATAGAGCACGGGCCAGCGCAATACG
CATGCGCCAACCACCGGAGAActccttggtcttcttgtccaTCATGGCGTCCGAGAACGTCAGACCCGACAGAATCTGGCGAGCGCGGACCTCGGCCGTA
GCggcgtccatgtcgtcgagACGCTCGTACAGGTCCGTGAGGCGGTCCGAGATGGACTcgctgtcctcctcgctgatGGACTCGTCGGTCATCTGCTCCG
AGAGCAGGTCGGCCTCGGCCTGGAGCTTGttgcgctcctcgtccacggacagcacggcctcgagcgccgtcATCTCGCTGGCCTCGATCTCGTGCTTGAG
GTGGTAGATGTCGATGCTGTCCGGGATGGGGATGCCgcgcgcgcccagcacgttcaTGAAGGTGGACTTACCGGAGCCGTTGCGGCCGATGAGGCCGTAG
CGGCGGCCGAAGTTGAGCGAGATGTCGCACTCCTCCATGAGCACCTTGCCGAAGTACGTGATGCTGAAGTTGAGCACGttgatgtccttgaagtTCTTGT
GCACCGAGCGCACGTTATGCGAGCACGTGGCGATGATGCCTTCCTCGGCGAGGCGGTCGGCGTGCGACATgttctcgagcgcctcggccttgtcggcggc
cttcttctcctcggccgccttcttgcgcgactccttcttgcccttgcgcTCCTTTTTCACGCGCAgttccttcttctcgcgggCCATGGCTGCGTGCTGC
GGGTGCGACTGCTACTTGAGATCTGTACGGCCGAAGGGCTGTGCGCCAAAACCACCAATACGGAAAGTGAGCCAAGCGAATGCGTGGCGCAGAGGAGGTT
TATCCCTTCGACGATTAAAACCTCGCTCGGCTCTGGAAAGGAATAGCGTAC