Description :
From Genome Similarity Track
Location :
scaffold_100:7650- 8671
Transcript NameFunction/comments
Pl_109757hypothetical protein PHYSODRAFT_496113

Sequence
1021 bases(100 bases per row)
TGCCCTTCAACTCGGCGACGACACCAAAATCACTACACATGCACAAACTTCCCTCTCCTTGCCACCATCAACCTTGCGTCAGCCGGAACTTGTTGTGCCC
GACAGCCGTCTGCCAGCGCACGACGCCCGCCACGACCTCCATCATGAGGTAGCGCAGATATTCCATCGGTTGGTTCTCCACGGTGCCACCGAAGGTCACC
TCGCACGCTGGGATGCCCATGGGCGTCGTCTTCTCCAAGAACGTGTACCAATTGAAGAGGTGCACGTAGTTGCTCTCCGTGGCTGCAAACTGCCGCTGGC
CCTCGGACAGCGGGATCGAGCGGTACGTGATGAGGTAGCCGCCGTCGATGCGGCCACGAGCAATTAGCAGGATCGAGTGATGCACCTTGTCACCGTTGCT
CACACTCAGCCGCACGATGGCACAGTCGTCGGTCACACGCTGCAGCAGCACAAGCGCCACTGTGCGTGGCTGCATGTGGCGATACAATTTGAAGTCCGTA
AGTAGATTCCACGTCTTGTACACCAACTCCGAGGGCGGGACGTACTCAAACTGCTGCGACAGCATAAACCGGAGCGAGGTGGCGTTCAGAATGCGTTTGT
CACTCCATCCCAGCACTTCCGTGTCCAGCGACTCAAAGTCGCGTTCGGCACGGAAAGCCATGATGGATTCATAACTCTCCTTCACACAAGCCATGACGAC
GTCCAGTGGCAATGGGCGATGGAAAAGCACACGCTGAAAGATGGGAGCCTCTACGAGTCTATCCTCGTCCGCGTCCGTCTCATCAGCGTCATGGCGTGCG
GCTGTCGCATCCGACGAGGACTTGGCTCCGTATTCCGACACAATAGTCTGATACGTGCTGTTCTGCATGTCAAAGGCGCGCAGTTTCTTGCGTAGTTCCT
GCTGTTCCTCGCGGAGCTGGTCGATGAGCGACATGGTGTCCAGCAGCGCTCGGTTCTGCGACAGCGTCTCGCGCTTGAGTCTCGATCGCTGTCGCTCCAG
CGCCTCCATCTCTTCCCGCAT