Description :
From Genome Similarity Track
Location :
Scaffold_9:764935- 773544
Sequence
8609 bases(100 bases per row)
GGGGTCCTATGATATATACACGCGCGACGGGTGCCCTTATAGCCATCCGCGACTCATCCATCTCTTATCTCGACCATTATGGACAGGGCACTAAAGTATA
GTACGGCGTACAGACACATCGACCTGCCAAGCACACCTGGTCAACACTACCGCACACTTCCTCACGTCCATGTAGACAGCAACTTATTTTTCGCGCGTTG
TGCTAACTCAATACTGTATATTTAATTTCGAGTGCGCATTAGTGTGATATACGCTATGAGCGTTGGTGGTACATATAGCATGATTTAGCTTGTGTCCAAA
TGAGTGAGTGTACTTGCCGTCTACGGTGACGCGTATGCAGATAGGGGCGGCCAGCTTGCAGAGGTACACAGTAGATACCGTGCGCTAAATATTATTTGAA
ACGCGCTACGCTATTTAGATGTGTCAACACTACTGACTGCGCCATAGGCAGATTACCGTATGTGCGGCCCCAAACCTCGAGCTGTCAGCCAATATACTAA
ATAGAAAGATAGGTAGGAAAATGGGGACCTAAAAGAGCATATTTTTCCAATTACTTTCTCTTCTGCTGTTTGTATTGCTCGATGTACCTGGCGTTTCTGG
CGGTCAGCTTGCGAGGGCGGCAGAGCCTTCTTTCTTCTTGAGGTACCGGTCAGGACCCATCGCCTTCTTGACGTTCGCCAGGCTTTCCTGGCGGCGCACT
TCGGCCGAATCAGGTGGTGGGGGCTTTTCCTCCCAGAACTCAACCGCCTTTGGGCCGTTCTCGCAGGCAAAACAGCGCCGCACGATGTCCCGCCCGCTGA
TTGTACGGAACGCGTAGCCGTACTGCAGCTTCCCGCAGCAGACGCAGCGCGCCCGGACATCCGTCGTAGACCGCTGCGGGTTCAGCAGAAGCGGGTCAAT
CTTCGCCTCGCATTGCTTGCACGTAGGGCCCACCATTTTGCAAACTGTGAGTAAGTAAGCAACATATATTATTTTAACCAATTACTTGCGTCCAAATATT
AGCCAATAGCACGGTAATGTAAGGCTGGTGTTTATTATTAAGCAACATATTAAAATGTTTTAAATATTACTATTTTGCTTTAATAGTAATACTATCAGAT
TTTTTAGCAAATACATACTTTACATGCAATAAAAGTGACTAAAAGACTATGTACCGTGCGCGCATGCATTCGTCGGGTGGGGTGCACGGGAGCAGATAGC
GCAATGACCGTGCGGCCGCGCGCCTTCATTGCACGGTGGTAGTGGTGAGTGCCAGGTGACGTAAAATATATATATATATATATGTTCGCAAAGTCCCTAC
AAAAAGCGCTGGTCGTGAAGCCTACTTTAATATTAAAAAATACTATCGTCTCTACTTTAGATAGTGTGTGGAAAATAGCATCGCCTAGCTCTTACAAATG
CGGTCTGTGAAGCTTATATTAATATCGTCTCTACTTTGAAAATTGTGTGGAAAATAGCATCGCCGAGCTCTTACAAATGCGGCCTGTGAAGCTTATATTA
GTAATATTAATACTATTAATATCGTCTTTACTTCGAAAAGTGTGTGGTAAATAATATCCCTGCGCTCTTACAAAATACTGGTCTGTGAAGTCTACATAAA
TAATATTACATATCTCTAAAAAGTGTGCAGAGCTCTTAGAAAATAAAGGGGTTACTGTGCCCGATTTGCAGTACATACGACAGGTTTTGCGTAGCTGAAC
GCAATAATCAAGTATCTGCTGGCTGTTTGCAACCAATCGATGCGTTTCGTGCTCGGCAGAAATGTTTACCTTACGTCCAATCGCGAGGGAGAGAGGCGGT
CTGATCGTGCGACAGATCCAGTCAGTGTCGCAGGTCGGCAGGTATTGCCCATCAGGGCGCGAGTTAATGTGTCACGCTTTTGGATATATTTGTAATTTGG
CATGAGTTAGGTCTAATCAGAAACATAGGCGCGGTCGTAGAATGGGAGGAAACTGTATAAGACAGGCCAAGGTGTAGCCATGGGAAAAGGGCAGGAAAAA
GCAGCAAGACGGGGAATGGGACGGACTGACGGACGGACAGACCGACAGGTTACAAGGTTAGAAGCGGGGAGACTAGCGGTCTGGGCGTCCGCTTCGCGGA
CGCTAGGCCATGGTTGGTTGGTGTAGAGAGGGCCGACCACCTCCGCTGCGCTGCGGTGGGCTTATATTTTCTACTTAGAGCGAAGCTACATATAAAAAAA
TGTGTACTGTGATCTACTTATGTCACGGTTCAAACCAACAGTGCGCACAATTTTCTCAGTGTTCACGTGTTATGATAGACTTGACCAGGGCTTAACGTGA
TCTGCAAGATGAGAACTATCTTATCCGAGAAGGTTCTGTCGGAGTTCTCATTTTAAGCATTGCTCCCAAGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTA
CATAGGTGCTAGATCCTTCTTCCTCGCGTGGCCTCCATCCTTCTTTGGGTTAGGTCCTGGGGAGTAGCTACAGCTACGACCGTCGCAGTCGCGCCCTTTC
TATGTCACGGTGCCAGTGTGAAGTGCGTCCCTATGAACTCAATACGGTGGAGGTGATTCTTCGTCAAGTCCCAGGTGAAGTAAAAAAAAATATATATTCG
CAAAGTCCTTCCAAAAAAGCGCTGGTTGTGAGGCCCTACTTTAATATTAAAAAATACTATCGTCTCTACTTTAGAAAGTCTGTGGAAAATAGCATCGCCG
AGCTCTTACAAATGCGGCCTGTGAAGCTTATATTAATATCGTCTTTACTTTGTAAAGTGTGTGGAAAATAGCATCCCAGAGCTCTTACAAAATAATGGTC
TGTGAAGTCTACATTAATAATAATAAATTTCTCTATTTGAGAAGTGTGCAGAGCGCTTAGAAAATAAAGTGGTTACTGTGCCCGATTTGCAGTACATACG
ACAGGTTTTGCGTAGCTGAACGCAATAATCAAGTATCTGCTGGCTGTTTGCAACCAATCGATGCGTTTCGTGCTCGGCAGAAATGTTTACCTTACGTCCA
ATCGCGAGGGAGAGAGGCGGTCTGATCGTGCGACAGATCCAGTCAGTGTCGCAGGTCGGCAGGTATTGCCCAATCAGGGCGCGAGTTAATTGTGTCACGC
TTTTGGATATATTTGTAATTTTGGCATAGTTAGGTCTAATCAGAAACATAGGCGCGGTCGGTAGGATGGGAGGAAACTGTATAAGACAGGCCAAGTGTAG
CCATGCGAAAAGGCAGGAGAAAGCAGCAAGACGGGGAATGCGACGGACTGACGGACGGACAGACCGACAGGTTACAAGGTTAGAAGCGGAGCGACTAGCG
GTCTGGGCGCCCGCTCCGCGGACGCTAGGGCATGGCTGGTTGGTGTAGAGAGGGCCGACCACCTCCGCTGCGCTGCGGTGGGCTTAGAATTTCTACTCAA
AGCGAAGCAACATATCGTACTTGTATACTGTGATCTACTTATGCTACGTTCCAAAACAACACCGCACACAGTATCTATAGTGCTCACATGTTATGGTAGA
CATGACCAGGGTTTATCGTGATCTGCAAGATGAGCACCATCTTAGCCGGGAGGGTTTTGTCTATAATCTCGTTTGAGCGTATTGCTCCCAAAATGACCCC
AATCGGAGGCGCGCGTGGTTGCAACGCTAGTATATGCTGTACGGAAGACGGGTCAGTATCAATGATGCTACGAAATATACGTTGATCGGTGAGGAATCCC
AGTGTAGCTGGCGTAAAAACGCCTACTCAATCATATTTCCATCTGCACGTCATCGCCGTGAGGCAGTCGACACATATCACCGATTGCGACGGTCTAATAG
AGCAATGTTAATCAGCTCCTCGCGCGAAGTATCTTTTAGGATAGGTAGTATATGCCGATGGTCGCCACAAACATCAATATTATGCTTTGAAATTATTCTG
CTGAGCTGTTTGTGATGTAACTGAAGTATATTTTCACTATCTTCCGCATGCATTGATCTTACTTGCATAGCTGACGTACTTTCTGACTTATTTGTATAGC
TTCTGACTGACAGAGTGGCGTAAATCCTTTCCGACTGACATTATACTGGGTCCGATTTGTACGACAAAAGGCCTCGTCCACATCGGACGAAGAGGCACCA
CTGCGTGCACATTCTTTTGACCGGCTGCAACATACGAAGATATATGGCTGTAGGCAGAGTATCAGATCGTAGTGATGGTTAGACTTGAATTGAATAATAG
TTCATGTACATTAGATGGAGTACTTTCGCTGCCTACTTATCAGCTCGGCGTGCTATTTGATGTGTCCGTGCATATCCCGCAATGCCGCCAATGGGTGTTG
TCGTGATAGCCAACACCCATGCACTGGGTTACTGCTGCGATCTCGGTACTTTTGTATCGTCGTGCTAGCCTACTGTACCTACGATTATGATGTATCCGTC
TATATGATCCAGCACGTCACTATTCGGGCACAGGTCATACCCGCGGTGATACAGGCAAGCTGATCAGGCGTCTGTTAGCAGTATTCAAAGCAATATATAC
GCGCGCGGCGGGTACACATTATAGCCATCCATGACTCAACCGAGCTCTTATCTCGGCCATTATGGACAGGGCACTAAAGTAAAGTACTGCGTACAGACAC
ATCTCCTTGCGATGGCCGCTTGTATGGTCATCACTACCGCATACGTGGTTGTGTCCATGTAGACAGCAGCTTATTCATCGCGCATAGTGCTCACTCGATA
CTGAAGCTTACATTCGTGAGCGCACATTAGTGAAATATAAACTGTGAGGGTTGGTGGTACATATAGCATGGGTTTGCGTGTGCCAAGTGAGCAAGTGTAC
TTTCCATCTACGGTAACGCGTATGCAGATAGGAACGGCCAGCTCGCAAGGATACACAGTAGACACCATGCGCTAATTATTATACGAAACGCGCTACACTC
CGTAGATGCTTGGCAGCACCACAGTTAGTTTACCATATGTGCGGCCCCAAGCCTCGCGCCGCCCGCCAGTATACAAAATACAAAGATAAGCGGGGTAACG
GGGGCAATAAGGATATATTATCCAAATTACTAGCTCTTCTGCTGCTTCTTTTGCTCGATGTAATTGGCGTTTCGGGCGGTCAGCTTGCGAGGGCGGCTGC
GCCTCTTTTTCTTCTTGGGGTACCAGTCAGGACCCATCGCCTTCTTGACGTTCGCCAGGCTTTCCTGGCGGCGCACATCGGCCGAATCAGGTGGTGGGGG
CTTTTCCTCCCAAAACTCAACCGCTTTTTGGGCCGTTCTCGCAGGCAATACAGCGCCGCACGATGTCCCGCCCGCTGTTTGTACGGAATGCGTAGCCGTA
CTGCAGCTTCCCGCAGCAGACGCAGCGCGCTCGGGGATCCGTCGTAGACCGCTGCGGGTTCAGCAGAAGCGGGTCAATCTTCGCCTCGCATTGCTTGCAC
GTAGGGCCCACCATTTTGCAAACGTGCGGATGTTAGCAAAATATTTTGTTTTAACCAATTACTTGCGTCCAAATATTAGCCAATAGCTTGGAAATATAAG
GCTGGTATTTATTATTTAGGCAAAATATTAAAATGTTTAAAAATATTACTATTTGGCTTAGCTTTAATATATTATTATCAGATTTCCAAACAAATACATA
CTTTACATGCAATAAAAGTGACAAAAACAATTATCTATCGTGCGCGCATGCATCTGTCGGGTGTGGTGCACGGGAGCAGATAGCGAAATGCCCGTGCAGC
TGCGCGCCTTTCATTGCACGGTGGCAGTGGTGAGTTCCAGGTAAAGTACAAAATATATATATTTCGCAAAGTCGCTACAAAAGCGCTGGTCGTGAGCCTA
CTTTATATTAAAATACTATCGTCTCTACTTTAGAAAAATGTGTGGAAAATAGCATCGCCGAGCTCTTACCAATGCGGCCTGTGAAGCTTTATATTAAGCA
TATTAGTACTATTAATATCGTCATTACTTTGAAAAAGTGTGTGGAAAATAACATCCCCAGAGCTCTTACAAAATACTGGTCTGTGAAGTCTACATTAATA
ATGATAAATATCTCTATTTGAGAAGTGTGCAGAGCTCTTAGAAAATAAAGTGGTTAGTGTGCCCGATTTGCAGTATCTGCGCAGCTCGCCTGGCCGTTTG
CATCCAATCGATGCGTTTCGTGCTCGGCAGAAATGTTTACCTTACGTCCAATCGCGAGGGCGATAGACGGTCTGATCGTGCGACAGATCCAGTCAGTGTC
GCAGGTCGGTCGGTATTGCCCAATCAAGGCGCGAGTTAATCGCGTCACGCATTTGGATATATTTGTAATTTTGGCATAGTTAGGTCGAGTCAGAAAGGTA
GGCGCGGTCGGTAGGATGGGAGGAAACTGTATTAGACAGGCCAAGTGTAGCCATGCGAAAAGGCAGGAAAATACAGCAAGAAAGGAACCGGACGGACTTA
TTGACAGACGGACGGACAGGTTACAAGGTTAGGGAGCGGGGAGACTAGCGGTCTGGGCGTCCGCTCCGCGGACGCTAGGGCATGGTGGGTTGGTGTAGAG
AGGGCCGACCACCTCCGCTGCGCTGCAGTGGGCTTAGAATTTCTACTCAAAGCGAAGCAACATATATTATATGTATACTGTGATCTACTTATGCTACGTT
CCAAAACAACACCGCACTCAGTATCTATAGTGCTCACATGTTATGGTAGACATGACCAGGGTTTATCGTGATCTGCAAGAAGAGCACCGTCTTATCCTGG
AAGCTTTTG