Description :
From Genome Similarity Track
Location :
Scaffold_433:7648- 9410
Transcript NameFunction/comments
Phyke_g9419Major Facilitator Superfamily (MFS)

Sequence
1762 bases(100 bases per row)
ATGGAGGCTCACGTGGACGTCAccgagaagctgctgcccaaCCTGGAGCCTGAATCGCCTCGTCGTCAGCGCCAGCGAGCCGGGGAGCGATCCGCTGCCG
CGATGAAGACTAACCGCACCGAGAACTCCCGCTCTCAGTCAACCCCCATCGGCTGTGGTTATACTGGGAAGCTCCATCTATCAGCGTGGCtgatctccat
ctcctccttcatgtGGGGCTTCAGTATCTCTGTACTTAACGTGTGCATCGTACCAGACGCTGTGGGGTCCATTCTCGTGGAAATTAACCTCAGTACAGAG
GAACAAGAACGAGCAACCGCGCTTGTCGTGGTTGGGTGTGTGCTCTCAGCGCTCACAACAGGTGGCATAGGAGCTCACGTAGGTCAGAAGAAAACCATCC
TAGTTAATAATATATTGTACGTGGTGGGAGGTGCTCTCTGCGCGCTGGCAACCTCCAAGCGGGAGCTTTACGCTGGTCGACTGACCATAGGACTGGCATC
AGGGGTTGTGACCAATACGGTGCCTATTCTACTGACGGAGATCTCGCCTGCAATTTCACGTGGAGAGATCACGTCGTTCCATCAGCTCAATCTGACGATT
GGCATGTTGGTTTCGGCACTGTTGGGGTTCTTTATCATCTCGAACGTGCCCTCGGGGTGGAGATATCTTAACGGGTTCATGGTGCTGCCGCCGCTGGTGC
AGTGTTTGACCATGGTGCTGATCCCGGAGAGTCCgtggtggttgatgaagaatCGTGGACGTGGTGAATGCCGCGCAACTCTGGTGTATCTACGTCCGAA
CAACGAGAAAAGTGCAATTgagacggagctgcaggagatcgcACGCGTGATGGAACACCGTCAGAATGAACCTCACGTGACATGGTCTCATTTGCTTGCA
CACAAGAAGATTGTGATGACAGGAGCTACCCTCGTGTTTTTCCAGGCCATGACAGGCATCAATACGGTGATGCTGTACTCAGCCAAGATTTTCCACTTTG
CGGGTGTGACAAGTCCATTCTTCGCCACGGCCATTGTGTGTTTTACGAACGTGGGCGTAACTATCATATCAGTGCGGTTTGTCGACTCGTACGGTCGCCG
ACCATTATTGATCGTGGGAACTGCGCTCATGGTCACCTCCCTGATGGTGCTCAGTTGTTCCCTGCTCTACCTGAACCATAACCTTGAGGTTCAGGGGATA
GTCGCTGTGGTTTCTGTATTAATGTTTGTCGGTGGCTTCGCAGTTGGTCTTGGTGCGGTCGTGTGGTGCGTTTTGAACGTGTCGATACTTTTGTTTGTAC
ATGCCTTACGATTGTTGTTTAATTGATTTTCCTTTTGTAGGGTGCTACTAGGGGACATCACACCAGTACACATTCGGTCACGAGCATTTTCGTTCTACAT
GGGCGTCAGCTACGTATGCAACATCCTCATCGCTGTGTACACACTATCCGCCATCAACTTTTTGGGACGTGGTTCGAATCCTGAGAAGAATGGTATTGCT
AAGCTGTACCTCATCCTCAGGTACGGGTGCAGTTCTTACCGTGATATTAGAGGCTTTGTAGTAACTGATCGGTCGGTATTGTGTGATCTTCAgtggtgtc
gctgtcgtaTGCCTCGCATATGTCTACAGCTTTGTAGAGGAAACGTCCCACATCAAGACGGCGCCTGCAACTCTTGCTGATGATCGAAAGGGGCTTTTGG
ATGCCGAGCGGGgggagctggacgaggagtATGACGTTCCACGCCAGACGACAGATCTATAG