Description :
From Genome Similarity Track
Location :
contig_115:76479- 78357
Transcript NameFunction/comments
g11273.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
ACGACACCGACTCGCGTTCCACAACGAAATGTCGGTCTCCGAGTGATGTGACTCCAGCCCGGACACCACCTGTCTTGCTGCAAGATGTTTACGTCGATAG
ACTGGTGGCCTTTTCACCTGAAAAGTCGGTGTGGATGAAGGCTAAGGTCTACAGACCTATTGGCACTGCGTACATCGTTGGAAGGGTGTGTCGTCAAGTC
AAGAAAGGCAAATTTGCTTCATTGTTTCAAGTACGTTGGCTGGACAGCCAATTCCAGAGCGCCGTGGAGCATCTCAGTGTGGGTGCTGTCCAACTGGCAT
CAAGAACTACGTTGCCCTCACGCGAATCAAGAATCCCGACTGGCATGTGTTGACGGAGCCTGATTCTTCCGAAGCTATTGAAGTCGGTGATGCCGAGTCT
GACCTCGTAGCAGCAGATGATCTCTACGAGGCTTTTGATGCATCGGAGCTTCTTCCAACCAGCCTGGACGAGGTTGAGGCAATTCGGAGCATGCGGTTTG
AGCCGTCAGCGCACGTTGAGGCACCTTCATATTTATATGAGCATGCCGATGGGACTACGAAGACCTACTTGCGTCCGGAATACAAGCACCTCTTCGATCA
CTCTGCGAGCTCCAGTTTCTTCGCGTACCTTCCGCTGTATTTTTGGCGCCAAGTCCTCCACGAGACGAACCGTTACGCCGCTCTAAAAGAAGTGAAAACG
TCTACGCCGTTCACACTGTCGGAGCTGATGGCGTTCCTCGGATTATGTTCTTCATGGCAGTCAACGAAAAAGGGGAGTACGCCAACTACTGGGGTCCCCA
GCCGGAAGACCTTATTTTTGGTGGGGCTACAACTTCACTAGACATTGTGATGACTCTAAACCGCTTCAAGTTGCTTAGAAGATGCCTGAGCTTCAATGCA
ACTCCGACGACACTCGAGAAGGATGCTGCTGCACGTATCCGGCCCCTGCTCAACCTGCTGAAATAACCGGTGGGCAATACGTCAACGTCGGTAGGGATGT
CGCCCTGGATGAGGCAAGCGTAGCTTGTCGCTCTCGTCAAGGACGCCACCTCATCGTGTACAATCCCTTAAAGCCAACAGGGAAGTACCATTTCCGACTG
TACATGATCTGCTGTTCGAGCACCTGGATTTCATTGAACTACAGACTTCATTGCAACCAGAGCGACATCTCCGATCGCTTGCATGGTGTTATAGGCCAAG
TGGAGGCACAGGATCTACGTGAGGAGCTAGAGAAAGTGTCGAAGATTCGACAACACGTTCTGGAGGTGGCACGACCATTTTTTGGGTCCAACAGGGTTCT
TAATATGGACAACTACTACACCAGTGTTCAGCTGCCCAAGAGCTTCGCCTAAAGGGTCTTTACGCCAGAGGAACGATACGAGCAAACAGCAAACACTTCC
CCAGCCACACTATCCTCCACAAAGACGATTGCGTGCGCGGTGATCACCGGCAGGCTGTCTCCTCTGATCATAGCATGCTTGCAGCCTCGTGGTGTGACGG
AAATGTGGTGAATATGGTGTCGAATGCTGACGCGTCAACTACCACTACCGTAAACCATATGATAGGAAATGAGAGGCGAGCTTTCTCGGCTCCTGTTTGC
GTTGCTCGATACAACAGGAATATGCAAGGGGTGGATAGACTCGATCAAATTCGAGGACGATTCTCTATTGCGGACGGGCACTCCTACAAGCGCTGGCATA
AGAAACTTGCCTTAGCGTCATAGATGTTGCAAGATCGAATGCTTACTTGACACGACGGCTGGCAAAGCCCGATTCTACTGCACGAGATCCCCATCGAGCG
TTCGTCACTGAATTGGTGGCCGAGCTCATCAACGGTCAGTGGGCTGAAGCGCCTAGCGAAGGTCGTATGCTGTACACA