Description :
From Genome Similarity Track
Location :
Scaffold_41:76472- 90723
Transcript NameFunction/comments
Phypl_g1586DNA mismatch repair protein Msh6, putative
Phypl_g1587conserved hypothetical protein
Phypl_g1588hypothetical protein
Phypl_g1589RNA polymerase-associated protein CTR9
Phypl_g1590hypothetical protein PHYSODRAFT_284208

Sequence
14251 bases(100 bases per row)
TGGGAGAAGAACACGGAAGATGACAATATTGGTGCCATTCGCAAAGTCATTCCTGGCGCTCAAGACACACGTCGAGACGTTGGCGAGCGCCACTCTGGAC
ATCTGCACAAAAGTGTATCGCCAGACTGTTTAAGGAGATCCGTGACATCTCCATTCGGCTAGAAGCCGCTTACCAACTGAGTATTCTACATGTAGACCGT
TCTCCCAGGAAGTAGACCTACCTAGGTTTATTGTCCAAGTTATGGGGGTGCTACATCCTTGCCTCCATCTTTCCTTTTGCCTCACAAGTTGTGAGCGGAT
CTCCGATTCACTTCAACTTAGTGTGCGATACATCACGAGAAGTGGCCAATCGCGTCGCTGCGAGTTGTACTTGGAATTTGTATCGCGTTGTTTTGGCGGG
AGTGGCGCGCGCACACTTGCAAACCGCGCGCATCGCTaagatgaagcagaagacgcagagcTCTCTGCTGAGTTTCTTCAGCCCCCCGTCGTCGGAGGGC
GCATCGGCCAAGAAGAGGAATGCGCCTgccgcctcgaccagcagcaacggcagctcgaagaagaaggcggcggccaccaaGACGCAGACTAAGCGCGAGT
CGCTGGGCGCTACGCGCAAGAAGATCGAGTTCTCCcccaagctgaagcagaagacggcggagaaggagacaGAGGCTGACAATGTGGAGATGGAAGACGC
GGACAAGGCCCTGAGCGTGGGCGCCAAGCGCAAAGCGTACGAGGAGTTCCTGGGCACCAGctccgaggacgaggcggagcCCGTACAGACGAGCAAACCC
AAgccgaaggagaaggagaacgaTCCACGTAAGAAACGTGCCGGGAAGTTTGTCATTAAGGACGAtgacgactcggaggaggagcagccTGTGGCGCCGG
CCTCTCGTCGTCATAAGGGCAAGACAGCCACTCGCAACGTTGTGAGCAGTGAGGAGGAGTGGGAGCAGGACAGTCCCGAGGAAAGAGGCGATGAGGAGGA
GTCGGAATTTAGTGgcgcggaggaggagccttcggatgatgatgatgccgATGACCTGGTGGATGAGGAGTCCGAGGAAGAGTCTTTGCCACCCAAGAAG
CGGCGGAAGAGTGCTCCTGCAACGACCAAGGCGAAGAGAGTGCCCACAAAGTCTTTTTTGTCTCCCCCGCCTGCTGCTAAGAAGAAATGGAACGGGACGC
CTACGtcaagcagcaagaagtcggCGCCTTCGGCTGATGGGCCTGCCTTGCCCAGCTCCGTGGCGGGTGCTGGGAATCACATTCACGATTCTCTGCCTTG
GTTGCATGAGAAACGACGGGACATCAATGACAACTCACCAGACTCTCCAGACTACGACCCGCGCACTTTGAAAGTACCGGCAGAGTTCATGAAGAAAGAA
ACTCCGGCCATGGTGCAGTGGTGGGCAGTCAAAGCGCAAAACATGGATACCGTGCTGTTTTTCAAGGTCGGCAAGTTCTACGAGTTGTTCCACATGGATG
CGGATGTTGGCTTCAAAGAGCTGAACCTCATCTATATGAAGGGCGACAAAGCACACTCAGGCTTCCCAGAGATTGCATACTCGAAAATGTCGTCCCAACT
GGTAGCCAAGGGCTACCGCGTCGCTCGTGTGGAACAAACAGAAACGCCCGACATGCTGAAGGTCCGGAACACCAAGCTAGCAAAGAAGGCGAAGGTTGTT
CGTCGTGAGGTGTGTTCTCTACTTTCCATCGGTACGAATACTGTCAGCTTCCTGGACGCTCCTATTTCGTCGCAAGACCAAGTGTCAAAgcaccttctcg
cgcttAAAGAAGCTTTCGATACTACGCAGAAAACTGTTCGCTTAGGCGTTTGCATGGTGGACTGCTCTACCGGCGCCTTTCAACTGTCCGAGTTTGACGA
TACTGAGCAGCGAGACCGGTTGAAGACGCTGTTCGCTCAATTTCACATCGTGGAAATCGTAACTGAGCGGTTTAATATCTCCGACGACACAAAAGAGGTG
CTCAAGcacgcagcgcctgcagcgaTTCGTTCGTCATTGCGAGTCGGTAAGGAGTTCTGGGATGCATCGAAAACGATTGATGAAATCGAACGCGCGGGAT
ATTTCAAGGAGAATGGATGGCCGGAAGACATACTATATTTCCTGGAAATGGACAAAGTCGTAAAGTCTGAGGGTCAGCTTGCGATCAGCGCTTTAGGCGG
TTGCATTTGGCACCTGCGACGCAGTATCATTGACCAAGAGCTGCTTTCACTCTGTAACTTCAAGAGGTACAAACCTTCGGACGAGGAAGCACGCGAAGCG
CGTGCAAACAAGGAAGCTTTGtccgctgctcaagctgagCTAAACCAGCAGTACGTTGTGCTGGACTCGCAGACCATCCAGAACCTGGAAGTGCTTTGCA
ACAGCTTTAACGGCTCGCGCTCGGGATCCCTGATCGATATTATGGATAAGACCGTGACAAGCTTTGGCCGCCGCTTGTTCCAAGAGTGGGTGCTCAAACC
TTTGTGCAAGATAGGCGATATTCAAGAGCGACTCGATGCAGTTGAAGAGCTGGGTAACAGTGGTGACTTGATGATGGAGATCCGCGAATTCCTTCGCAAA
TTACCGGACTTGGAGCGTTTGCTGTCTCGAATTCACGCGCTTGGATCTGCATATCGCTCGAAGGAGCATCCGGACAGCCGTGCAGTTATGTACGAGTCCC
AGATATACAACGTCCGCAAGATTAAGGACTTCCTTGCCGTACTAAACGGATTTGACGACGCTATGAGCCTTACTCTCGAGCTGGGTCCTCGTCTCTCGCA
GTCCAACTCGCCAATTCTCAAGTCACTTCTGAAGAGGTGCCGTGTCGAGGACGGTGCCCAGCCGGGCATTACGCATGGACACTTCCCCGATCTTACAGAG
AAGCTGGAGTTTTTCAAGCGCAGCTTTGACCAAGCTTCGGCCAAAAAGAGCGGTGTGATCGTGCCTCAAGCTGGTGTAGACCCAGAGTTCGatgcagctg
gtgctgaaATTACTCAGATTGAATCCGAGCTGGCAGAATATTTGAGCGAGCAGCGTTCCGCGCTGCGGTGCCGACAGATTTCCTACTGGGGCAAGAAAAA
GGAGGACCGTTACCAATTGGAGGTCCCCGAGAGCGCTCTATCGAAGCAGCCCAAAGAGTATGAGCTCAAGTCTCGCAAGAAAGGATACAAGCGCTTTCAC
ACAGCAACGATTCGTGCGTTGCTGAAACGATTGGCTACAGCGGAGGACCAGAAGGAGGAAGCGCTCAAGGATCAAACTCGTCGCATTTTCCACAAGTTTG
ACGAAGACTACAAGTACTGGATGAAGGCGGTGCAGTGtctggccgtgctggactGCTTGGTGAGTCTCGGACTACTCAGCAGCCAGAGCGAAGGATACAC
GAAGCCGGAAGTGGTGGCGGCAAGCACCGCGAATGGAGGAACCGCTTTCATCGATATCGAAGAGGGCGTTCACCCTTGTGTTGCTGCAACCTATGGCAGT
GGCGACTTCATTCCGAATGATGCGCGACTCGGCATCGAAGGAAATGGTCAAATGGTTCTCCTCAGTGGACCCAACATGGGTGGTaagtcgacgctgctgc
gtcagaCTTGCGTTCTGACCCTCATGGCTCAGgtcggcagcttcgtccCCGCAGCCAAGTGCCGTCTTAGCCCCGTGGATCGTATTTTCACTCGAATTGG
TGCGTCCGATCGCATCCTTGCTGGCCAGAGTACTctgttcgtggagctggccgagacAGCAACGATCCTGAACCACGCGACCAGCCACTCGCTCGTCATT
CTGGACGAGTTGGGACGTGGTACGTCTACGTTCGACGGCACTGCCATCGCGTACTCGGTTGTCGAGCACCTGCTCAGCGACATCAGGTGCCGGACGATGT
TTGCTACGCACTACCACTCGCTGGTGGAAGAGTACTCGGGCAACGACAAGGTTTCGCTGGGCCACATGGGGTGCATCGTCGACCCGCAGAACGATCGCAA
GGTCACCTTCCTGTACAAACTGGAGGACGGCATGTGCCCCAAGAGCTACGGTATCAACGTGGccatgctggccaagctgccggacGAAGTGATCGAGTGC
GCCGCGAAGAAGTCGGAGCAGTTTGAGCGATCCTTGCAGGCCAACTCGcacacggagctggagagccTCCGACTCGCGCAAAAGGTGAGAGAAGCGCTGG
CAGAAGGCGAGGCGGGCATAGACAAACTCAAACAGCTCTGGGAGCAAGCACGCAGAGCTTGATGCCAtaaagtgtagccatctgaCGTCAGCCTATTCCG
AAATTACACCCGAAAATAACATCATACTGCAGCCGAATCATTCAGTGCTCAACCAGCAGAATGCGTCGTCAAGGGGTCCAGTCACTCGTGGAGCTgtccg
tggtggccgtggcgctcttcacgcccgtgcaggaggtgctcGAGTACCTGGAGTACCTGCCCATCGCCAtccgccaccagctcttCCGCGAGCTGTCCAA
CTTCCGTCTGCGCGAGATGGAGGTGGTATGGGAGGCGAccgcgcagcaggaggcacCGGAACCGCGCGACGGCTACGACCCCCAGGCCGGAGACAAGTTC
CTGTTCGACCGAGAGACGCAGCGCGTGTGGGAGCTCCGCATGAACGCAGCGAGACTGGGCTACGAACCGATCCCCATCGAgaacacggcggcggcccAGG
GACGCAGACGCAACCTCCGGCACGTGTTCTGGGAGCATCAGTTccgcacgctgctcaagctgcgcacACCATTGGAGCTTTCAGGACCCGttgacgtgct
ggtggactgCCAGAAGCTTttcgtggacgtcgtggaggtgctgaaggtgcACGGCCGCGAAGTCTGCGAGGACAATGCGAACTTGATTTTGGCGCTCCGG
CAGCTGCGGAGACTCGAGGTGCATCATCCAGAGCAGCAAAATACTTGCTGGGAGACTATGGGGAAACTGATGCAGAGCCACCCGCACCTCACGGAGCTGG
GCTTCTTCCATGGGAAACTGAGTGATAACCAAATCGCGCAGACCCGCAATACGCTGAGAAAGCCGAACCCGACGTTGGACAAGACACTGATTACCAGCAG
AATCACGACGCTGGAGTTGGTGTCTGTGAGAATTCGACCTGAAGGGTTTCGTCAACTGGTGGGTCTGGTGACTGAGATGCCAGAGCTTACCCAGTTGAGA
CTCAGCAATACCATCACGGATTTcgacgcgaagctgctcatCGACGCAGCATTTCGTGCCccaaagctgcagcgactctTCTTGGAGCACAACGAGTTGG
AGGACGACGCATTCACAGGCCTCTCCAAACTGCGAAAGCCACTGGCATTACGACACCTCCGTCTCAGCGACAATGACGTGTCTTCTACAACCGTGGGGGC
GATCTGTAGCGCAAGTATGGATGGAGTGCTGAATCTGGAGCGCCTTGAATTGACCAACAACGTGCAGATCGGCGACCCAGGTATACACGCACTGACACCG
ATGCTGGCTTcccaaggcgctggaccggCAGCGGTGCTGACCCAACTTGACGTCGGTGGCTGTAATTTTGGTCTTGAAGGTGCCACCAatctgctgcttg
ccctGGGCCAAAACAAGACGGTCAAGCATTTGAATGTCGCTCAAAACTTTTTCGACGTTGGCTTCGGTGATGTGCTTGCAGACTTTCTGTTTACCAATGA
TTCTGTCACACATCTGCAAGCGAATGGCATTGGACTGGGACTCGCAGGTGTGTCCGCTCGACTACTGACAGCGTTAGAAAGCAACAGCACCCTCACGTCG
CTTTCGATGGGAGCGAATCGGTTGCGGAATGACGGTGCAGCCGCACTACTGCGATCGCTGGTAAAGCGAGCTCAGGCGAAGCCATTCACGTTGGTCGACT
TGAGCGGAAACCTACTCACATTAAGCGGGCTTGCGATGATAGCCGACATACTGGGAAACCCCGCAAACACCAACGCTACACACTCCGTCAGCTCAAGAAg
agatggcgtcgtcggagaGGGAAACGCACAGTTCGATCGGAAGCGCCGCCGTACCAATAGCTCAGACAATCGCCGAAACTCGTTGAGTCCTCGCAGCACC
GTCAGCAACGCCATTGAAGAGCTGTGCCTGCTGAACAACGACTTcatcgagaacgacgactaCGTGGGAGACCGTTCGAAGCTAATCGAGTCCATCCAAC
GCCGCGTTGGTCACCTCAAAAGCAATGAGTGGGCAATACAGCACCAAGTCTACGACGATGAGGTATAGATCAATAGAAAAAAATTGTACTTAAACTCAAT
ATGTACCGTATTGAGGAACTCGTCGGCATCACAAGAGTGATGGCCAAAATGGCTCCCCAACGCTTCAAAAACCTGGATAACTACACAGAAAATAGAGACC
CCCTCCTGGACAGCATCGACGACCAGCGAATAGCACGCAGATTCACAGCACAACAGAACGACATGGTGATAGCCATCTCAAAGTCCCCGCCTACCACCTC
AAGAGTCAAACATCGACATGCTCTCTTGAAAGCCGTACTCACGGTCGGCATATTCGTGTTGGCACCACCGATCTTCCTCTCGCTCGATCTGTATACGCTG
CTTTTCTTGTAGTTCCGCCACTTGCGAATCCAAAGAGTCGAGCATGCTCTGAAGCGGGTGAGGAGTTTCCTCAAGCTCTCCATCCGAGCTAAGGCTACCA
CtctcttctccttcgtcgtAACCATCGTCTTCCctgtcttcatcgtcttcatcgtcctcATCATCTCTGATTGCTGTGGATGCCTGTTCGTCCAGacggc
gcttcttggccaagTCAAAGTTCTTTCCGTATTGCTCATCTTTGCCACGCTTAGATGGCTTCTTCGAGTCGGCTGAAGAAAATTGTCTCGAAAGCGGGTA
CAGATTGTTCAAAGGTGAATTGCCCTTTGAATGACGGTGGATATTCTTCGTATCAGAGATATTGCTCGAGCCCGACCCTACAGAAACGACAAACCAGCAA
ACACGATTCATGAGTTTTTACACACCAGCATAACCCGAAAGCCCATAAATCACTACGCACATGCATTATCCGACGAGCCGACGGAATGGTTATCGAGGCC
ATCCTCCTCCAAATCAGCATCAGCGTAACCTCCATCGTCCCAGGTATCCTCTGTTGGTTCCGGTAAGTAGAGAGGGAAAAGCACGCGTAACGTGAGTCGA
TGAAAGTACATCGCAACTGTACAAGTCAACAAACCTGGGCTGGATTGCTTCTCAGCAGTGCCCGAACTGTgttcgtcagcagcatcttcattGCCTGTCT
GAGGTGTCTGAGTCGGTGAGTCGAGAAGAGGAGACTGTTCATCTTCGTGTTCGTCCCCTTCCATAGCAGCAGATTCATTGACTGTTTGAGGCGACTCGAG
AAGAGGAGATTGTTCATGTTCATGTTCACGCTCACTCACATGAACACCAGCTCCCTCCTTGTTTATTTGAGAGATGTCATGAGCGGGAGATCCCAGAGAT
GGTGATTGATCATGGTCGCATTCATCTTCACTGAAAATGGCTTCTTCAGAGTTGCGCGAATCGCTAGGACCCGTCTTAGCCATACCACCCTGCGCGTTAG
CGATGGTCGAAACAGCATCCATTTGACTGTCACGCGCGCGATCTTTTGGTTTTGTTTCTTGGCCCAAACTTGCTTTCGGCGAATTAATATCTGGCACCGT
CAAAACGAGATTCTCGAAGCCATCCAATGTGCCGAAACCTATATCGATAGCACACAATAGACGTTGTCAGTTTACGCATCGCAAGTAGACGACCGTTCTG
AATGACGTACGCTTCTCAAATTGGGTTAGAATGTGCTGGGCATCTGCAAACAAATCTTGAAACGTGACGCCTGAAAACGTCATGTTAGCTCTCAACTATG
AGGCAACACTCAATGCAATTCTGGTTTGAGGATCTTCTCATTCCGTACCTGGTGTCAAGCTTGAAATCGTGTAGAAGAAATCGACCAATTTGTTGGATCG
GTACAAATCTATCGAGTGTTGCATGCACCGAAGAACATTAtgcaccaccttctccacccACTGGCACTGCTCTGCAATATCCTGGACAAACGCCGCATAA
TCGTCTGCAGGTATCATACTTGTTGGTGGTCTCTCCGACTGCGACACTGCAGCTGTCTTGCTATTAAGTGACTCTTTTGCAACAGGGTTAGCTGTTGGCA
gtagtgcagcagcttgcgcagacGGAACCACTGGGCTTGGGATTGAGCTTGCCGTCCCACGAGCTGTCATTGTTGCCGACCGAAGCTTAGGTCGTGGTGA
CCAAATGCTTGTGTTCCGTCGTTTTTTATTACGCTCACTATTCAGTCTGAGCCCTTTTTAATCCACCAAAAGCAGTTGTCAGTGAAGTGGTCAATGCAAC
CAGATGAGCAATCagagcagcgcaagaacgTACTGCGTGACTTGATCGCTATGTATCCAAGCGAGTAAGGATCGTTGTTATCACTCCAATCTTGATTCAA
AGTAAATGCAGCTGGGGTTAGTGACAAGCAAGCTCATTCCACATCAACGGTTGAGGAAGGGCTTTACCTGCGCTAAAAATCTTGTACGCTTCTGAGGCTG
GATCAAAAATCGTGTCAGGTATATCTAAAATTCCCCGAGCAACGTATTAAAGTCAGATCACATCATGAAGCATCAAACGAGGAAACAAGGAAACGGGTGC
TTACTCGCTGCGCGAACCGTTGTCGACTTTTTCAAGAACTTGTCTCTCATGTCGGCCAACTTATTCACGCATGACCCGTACGTCCGATCTGAATACATTG
GCAGGTTTTGTCgtgtcagcagcaacatgtaGCGATGTCATGAGGATATACACTTACGCAACGTCTCAGCGACACGGTCCACGAGGTCTGAGCTCCCAGT
TCTTTGAATCTGAATGGTGATCCGAACGAGGAAGTCAACAAGGGTCTCCATCTCTTGAGACGACCACATCTTCGGAGCTTTACTGGGCACTGCAGCTACT
TTTTCCACTCGACGGGCAGGTGGCACATCGGTGAAAATACCTTTCAAGACCTCAAGACGCTTAGTCCCCACTCCTGTTCGTTCTTCACAACAGCAAGACA
AACACACATGGCTTGTTCAGTCTCTCAAGCCCCCCGTGCATTCGAAGTTACATTCAAACCCTGTGGCGCACTTACGGCGCGGGCGACGCTTCTCCCTCAG
AAATATTTCACGCAGAGCGTAGAACTTGCTTTTCGTTTCCGCAATTGATTTTCCTAAACACGACAAAGGGTAAGTATCCTTGAGAGCGCCCCTCATCATC
AGAATAGGTACACGCTTACCCCACAGCTGCACCTGCTTGAAGTACGTCTCCTGGGTGTCAGTAAACCGATCGCGGtactgcttggccttctcgagGAAGC
GGCTGAGCTCGTCCGGGAGCCACACCCCGCCAGCCCTATTCTCCGGTAGCTGCCGGATCGACTCGTAGATGTGTTCGTAGACGTACACCTCTTGCCCGTT
CGTCACGATAACTGCCCCCGACAAGTTGCACCGGTTATTAACCACACCGTCGACACTAAGCAGTCAGCAGTCCGccagacagcagcagcaaacgtcAATT
GATCGCACCGTCCGTCCGGAAGTTCTTGGTGCTGAACCGCAGCCCAAACTCCTCCATCAACGCCCGCACCATCAGCAGAATCTCAGCCTCGTCCTTGTCT
ACCAATTCACGCGTCCCGAAAACAACCGAAAGCGCAGCAAAATCAGCCCCAAACGCTCGATATGAAGCACGGTATCCGATATTTTCGACAGTAAAAAGAA
ATCGTTTGACTTACCTGGCAGCTCTGCGCGCACCACCTCTGCGAACTGGTTGTCAGACGCGTACACGTAGCTCAACACGTGCTTGCGGaacagcgtcagc
agcgccaggacGTCCGCGTCGCCCCACCCTTGCGGCCGCACGAGCATCATCAACGATCGATCTTGTCCCCGTTAGTTTTagttgagctgctcggctgAAG
GCGTTAAGGGGTAGGTGACCAATAGTGAGTTTAAGTACTACGTCCGACGTCCGATCGGACGGTGGACCGGTCGCAGGTCGGCaaaagggggggggggact
TTTTAGTGTGGGAATTGGCCCAGAGCCATCGCCATGTCGGACGCTGAGGAGGAGTCAAGCaaccagcgcgcgctgctgatcCCCGTCAAGAACTCGGAGC
AGGCCGTGGAagtgttcgtggacgagctgccggaTGACGTCAATGACATCATCGACATCCTGCGCGCCGAGGTGGCGCCGCTCGACGTGTGGCTGCAGTT
CGCCGTAGAGTACTACAACCAGGGCCATGTGGCCCAGTTCCAGGAGATCCTGGCCGTGGCCTCGGAGCCCGGCATCGAGGAGATCTACAAGGACAACGCG
TCGCGCATGTGCCGCATCAAGTTCTTCATCGCGCTGGCCAGCCACGCCGTCAACGCCATGTGGaacgaagaggacgagaagaagcgcgaggccaTCTCCC
AGCGCGCCGTGggcttcttccagcgcgccGACCGCCTCGACCACCAGCACCCCATGACGCTCGTGGGCAAGGCGCTCATGTTCATGGCCAAGAACGAGGA
CGACCGCGCCGACCGCTTCATCAAGAGCGTGCTCATCTCCAACAAGACCAACCTGCCGGCCATCCTgggcaaggcgctgctgctgtaccgcAAGAAGCAG
TACAAGGACGCCAAAAAACTCTATCTGGAGGCAATCAAGCTGCACCCGCGCAGCCCGCAGGCCGCCAGCATGCGCATGTGCTTCGCCTACTGCTGCTACC
ATTTGGGAgccgtggagaaggctcGCTCGGTCATGCGGtacacggcgtcgctggatgAAACCAATGTGGACGCTGTGATCGCGAACGCGCTGTGGCAGCT
GGCGAGCCAGAGTcgcgaggagcgcgcggTTAGCATCCGCGACGAAAGCTCGCGGTTTATGATGATGATCCACCACGCTCACGCTATCGACAAGACGAAC
CCCACGGTGCTGAACCACCTTGCCAACCACTATTTCTCGCAGTGGATCCCGCTTCCGTGCACTGTGAGCGTGATGCGCGGATCGGCTGTTGTGGCTACAT
CCAAGGACATTTCCAGTGAGGTCTCGCCGGGCCAGATTATCTGCATTGGCGACAAGTACGTCGCCTACATTAGCcgtgacgaagatgccgtGTCGACCTC
TGGACTGAAGCTTGATGGGCCCTACCGCGATGAGTCCGCGACTGCCACGAACATTGCTCGAAAGGACTACGATAAGATGTTCACGCTCGCAGGGAATGCT
TTCCACAGCACGAAGATCCCTGAAATCCGCTCGGAAAGTTGCTACCTTATGGGACGTGGTTGCCACGCGCAGGGCAAGTACAAGGACGCCTACAGCTACT
ACTTCAACGCTGGACGTCTTTGGCCGAAGTTCGTGCTCCCCTGGTTTGGACTGGCACAGATGTACTACGAGCGCAAGGAATTCACGAAGGCTGCATCGTA
CTTGGAAAAGGCTAACAAGGGGTACCCGGAGAATGTTGAGATTTTGTCGCTTCTCGGCGATGTCTATGGCAAGCTTGGCAAGAAAGATGAGGCTGTCGTC
TTGCTTCGTCGTGTCGTTGAACTGGAGCCAGGAAACGTGGAGGCACTGATCGGTACGGCTGAACTGCTTCACGCGTCCCCGGACCGGAAAGACCAAATTA
TTGCAATCTCGTCGTACATTGCGGCGGAGAAGGTCATGAACAATGCCTCGGAGCGCGTGCCCATGGAAGTATACGTCAACCTTGGTGTGCTTCAGCAACG
CGTCGGCAAAACTGCTGACGCCATTACATGCTTTAAGAAGGCATTGAAGCAGCTGGGTGATGATAGCAGTGCTGACGAAGAAAGCAAGTCGGAGGAGGCT
GATGTTCTGGCTGACGAATCCTCAACCCCCAAGCCATCGGAGGCGAATGTCACAATTCTGTACAATATGGGTCGTGTGTACGAGGAAATGGGTAATCGTG
ACCGTGCCAAGAAGCTCTATGATGCGATCCTAGACATTTTCCCGAAGTACACCGATTGTTTGCTGCGCCTGGGCTGCATGCTGCGGGATCGTGGCCACGA
GGCTGAGGCGATCAAGATGTTTGACAAGGTACTCGAGGTAGACCCCACTTGTGCCGAGGCCTGCTTGCTGCAGGGCAACATTCACCTGAAAAAGCGTGAA
TGGGTGTTTGCTCAGAAGAAGTACGAAAAGGTGATGGGGATGCCTGGTCTGAAGAACGATCCGTATGCATTCTTGTCCATGGGTAACATCTTTATGAGCA
ACCTTGGTGAGAAGAATCGTTACACCAAGAACATGTCGTTGAGCGAAGTGTActacaagaagacgctggcgtcgcaCCCACACAATATCTACGCAGCCAA
CGGACTGGGTATTATGATTGCTGAGAAGGGCAACTTCGAGCTTGCGAAACAGATTTTCTCCCAGGTGCGTGAGGCCAGCCCGGATATGCCCGATGCCTGG
ATCAACCTCGCGCACATTTTCGTTGCTGAAGAACGTTACCAGGAGGCGATCCAGCTCTATACTGTGTGTCTGACCAAGTGCTACAAGGGACAGGACCTCG
AAGTGCTTCTGTACCTTGCTAAGGCCTACTACGAGTCGAAGGACTTCCCGAGCTGCATCGCTACGCTGTCTCGCGGCTTGCACATGTACCCGAACGACCT
GCGTCTTTGGTACAACACTGGTCTTGCCCAGGAAGACTATGCCGTGACAACGCTTGGACAGGAGACAACCACCGCACGGACAGGCAGTGGCAATGCAGTA
CCCCAACACCGTACGATGGCTGATGTGCAGCGCGCCATCCTGGATCTGAAGCGCGCACAACGCATTTTCCGtttccttctccagcaagcCGAGGcgacaa
gcagctcgagctctggtgagaagaagaagcaccacAACAGCCTGCccttcgacaaggagaaaGTGTCGGACCACGAGAAGTTTTGTGGTGACACACTGAC
AAAGGCTAGCTATCACTTGGAGTTCGAGCGGCAGAAGGAAGAGAAGCGCCGATTGGAGATTGAGGCCCAACGCAAACTGCTGCGCGAGTACGAGGAGCGC
GTGGCTCGCGATCAGGAGGAGGCGCGCGTGAAGGAGGATGACCTGCGCAAGCGCCATGAAGGCATTCGACTCAAGCAGGACGAGCGtctgaagaagctgc
acgaaggTTGGAGTGTACGCGAGCgtgaggaggaagagaagaaggtggtcaagaagaaaggaggaaagaagcgcaagaaaacGGATGGCGAGGACGGCGG
CTTTATCGATGACGGAGAGGACGAGttggatgaagacggcgacaACAGCATGTCGATCGAGGACATGAAGAACCGCAACGcgaccatgaagaagctggtg
gagaagcgcaacAAGCGCGCGCGTGTGGCATCTGGCTCGgaagacgagaaggacgacacAACAGGTCTCTTCGGCTCGGACTcaagcgaggacgagcagg
aggagtCCAAGGCAAGTGAAACAGACAAGGATGGCGACAAACCTGCTGCGGAAgatggcgcagcagcagaaaccCGCGAagccgagaagaacgagctCTT
TGGCTCTTCCTCCGATGAGGAATAGGGAGCGGCATCAATCCAGGATTGAGGAGTTAGGGGTCGTATGCTAGTagtttttcttcttcctaACGCTTTTTCG
TGTTGGATGATTCTTGTTGAAGCGAGTTGGTGTATGGATAAGCGCCACCTACTTTACCTCCTATcttgccagcagcgcgccctTTTGAAACCGAACATTC
ATCCCAACAGAAAATCAATTTCAAAACGGCAACAATGAGATTCGGTGATCGCGTTGGCGCCAAAAAACACACCCGTTGAATCCGATCGTATTGGCTTGTC
GGGATTGGCTAAAAACGTCTTCCAGCGTTATGATTGGCCGAAAGCAAGCgcacgacgatgatgaccCGAACCCATGGTAGAATCGGCTGGCCGGCGAGGC
GGCGAGGCAAAAGCGCGGGAGTCCGCACCGGATAGCCtctgcttggcgcgctgcgTGCGCCAGCTCTTCTGCTGGTCATTTCGGAATTGGCGCTCGACCC
AGCAAGCgactcctccagctccgctcTCCCAGCTCAACTGCTCGTCCCGCCAAGCAGCTACCCACCCCCTTCTAGTCCAGCAACCATGGTCGCTGCCTCA
TCCGAACACACCGCCGTGGACAAGGCCCCGGAGCAgccggagcaggagctg