Description :
From Genome Similarity Track
Location :
Scaffold_9:764615- 766560
Sequence
1945 bases(100 bases per row)
GCCGCGTCGGGATATGCGACGGACCTCACGGTCAACGAGGCGGAATACCGCGGGCTGCTGCTCGGATGCTCTCTTCTAGAGGAGCTCGACGACGTCACCC
GACTCGTCGTATGCGGAGACTCCAACCTTGGCATCAGGCAGATGCGGGACGAGATGGACTGCAAGTCCCCGGGGTTGAAGCTGCGGCGACAAAAGACGCG
AAACGCACTCCAGGCGTGGCCGCACCACGAACTCTTCCACGTACGACGAGACTGGAACGCGAGTGCCGACATGCTGGCTGGACAAGCTCTGCAGCGTCAA
GGAGGCCGCAACGCGCACAGCCCCGAGGAGATTCAAGATATGAAGATGCTGAATCGCTTGGAAGAAGTCATCCGATCACGGGCATCGAGTCCCGAGATGG
CGTCTCCAGCCAATCCCGACGCGGATAATCTCGACGCGGATAATCTCGACGCGGAAAACCTCGACTCGGAAAATCTCGACGCGAAAAATCGCGGCGCGAA
AACGCACGGCGCAGATGAACCCGCCGGAAAGGCATGGACACGGGACGCGGGACAGCACAAGTCCTCGCGGTGACGACGCGCTCGGCTGCCGCACGCACGA
CAACACGTATGGTCCGACCTCCAGAAGTCCTGGAGGAGCTGGTGGTGCAACGACTGCGCCTGGACCGCATCCGCGTCGCCCAGGACGAAGAAGTCTGGAT
CGCCAACCTCAAGAAGTATCTCCGCGGCGACGCCGGAGACCTATCTCGGCGCGAGGTGAAGAACTACCAAAAGCTTGCGCCTCAGTACGAAGAGGGCGAA
GGCGGACTGCTCTACTACCAGCCGAGAAGCGACGATTCCGCCGAGGATCGCGATGTGATGATGAAGCTGGTGATTCCAGAGACTCTTCGGGAAGATGTAC
TCCACCACTATCACGCGTGCCTGGAAGGCGGACACTCGGGTATTGGCCGCACGTACCAACGCGTGAGGCGCCACTTCCATTGGCCAGGGATCTTCAGAAG
CGTCCAGCGCTACGTCGGCGAATGCACCGACTGCGAGACGGGAAAGGGTCGGCCGACCATCCAGGGCGAGTCGCCGGGCAACATCGTCGCGACGTACCCG
TTCCAGGTCATTGCCATGTACCATACTCCGTCGTTGCCGGCATCCTACAAAGGCAACACAGAGCTGTTAGTCTGGGTCAACCTCTTCACGGGGTTCGTCG
TGGTCAAAGCGAATGCGTCACGAACCGCGCAGACGGTGGCCGAGGCGTACGAGGAGGCGGTGTTCAGGCGCTTCGGCGCGAGCGAGGCTATCCGCCACGA
CCGCGAGCCGGGCTTCATGTCCGACTTCTTCAAGGCGTTCAGCAAACTCATGGGTCAGAGCCAGCGAGCGACGCTCGCTTATCGTCCCCAAGCCAACGGT
GCTGCAGTACGGATGGTGCAGACGGTTACAAGAGCGATCAAGATGTACATCGCGGACGTCGATCAACGCGACTGGGACGAATACGCCGCGCGTCTTACCT
TCGCGCTAAACACGTCGCACGACCGGACGAGGAACGAAAACTCGTTCTTCTTAGTGCACGGCTGGGATCCTCGGTCGACGCTGGAAGCGACGCTGGCCGT
CGGGAACACGTCGACCCGGGACGCCGAGGCGAGGCGGTGGAGGCTCCGTGTCCAGCGACACTACAAGGTGGCAAGGACACAAGTGTTGGAGTTAGTCCGA
GAGGCCGTCGAAGAGAGAGCTCGTCGAAAAACCGAAAACGCGACGCAACATGAGATCGCGACGGGCTCGCAAGTTTGGCTGTACCTGGATCGGGTGAAGC
CGGGTTATGCGCGCAAACTCGCGCACATGTGGCACGGACCCTTCCGTGTCGCCGAGCTGGTCAGCGCGTTCGCAGTGCGCCTCGAGACGGCGGGCACGCC
CTATCAGCTGTACCCCGTCGTCCACATCTCCAAGCTGAAGCCCGT