Description :
From Genome Similarity Track
Location :
contig_2:76451- 77631
Transcript NameFunction/comments
g559.t1XP_008902925.1 hypothetical protein PPTG_09660 [Phytophthora parasitica INRA-310

Sequence
1180 bases(100 bases per row)
GACACTTGCTCCGAAGATGGAGAGTTGCTGGCCGGACGGAGAATGCAAGAATGAGGTCGTGCAGGGCGGTGCAAAGCATGAAGCGCCGCAGTCCTTCATG
GCAGTCGTCGCCTGCAAGAAAGCGCTGACGAAATCTGCCGGTGCTGAGTGCGGCTGGCGCGTAATTCCGCATATAGCGTTTCGTAAGATGGGAGAGTTTG
ACCCTAATAATTCTACCAATTGCATCACCACCATCAAGGCAACATCGTCGTCTACAACCCGTCGACCGACATGGCTACACCCAAAAGTTGCCTTTGAAGT
TTTTCTGAGTCTCATCACTAGCATTGTTTTGGGGGGCTCTTTTAGCTGCATCCAGGACAATTGTGCAGCGAGTCGTGGACGTACATATCACACTCACTGC
AGAACACACTCTGGCAGGTGGCGCACTCGTACGCGGCGCCTTCGCCGTCCAGTCCCAGAGACAGCAGGCAGCCAAAACACTTCTTCTGGACCAGTTCTGG
CGCTACCTTGGCTCCTTTCTCGCCGCTCACTCCAGACCGCAGCAAATGCTGCGTAAACTTGGCCACTGGGAACAAGTGGTGATAGGACCGGGCGAGATGC
GGCGACGAGACCAGTGGCAAGTTGCACACTTGGCAGGTCGTCGGTAGGTCGCAGCTCTTGGACTTGCAGCGAGGACAGACGTACCCCACTGTTGTGAACG
CTTGGTGGCAGGTGCAGAGCGACAGCGCTCCGCTGCGCCGCTGCGGGAACCCCATCTCTACGAGCGTCGCAAAGCGCGAAGCCGCCGTCGCTACGGTGGG
CGACGGGAAGGTGAAGGCCGTCATGAGCCTCTTCATGTGGTCGGCGTCCACCGCGACGTGGTAGGTTCCGTCCGTGCCGTCCGCAATGCGGCGCAGCAAA
TGCATCTCGGCTCCGATGCCAATGAAAGACACGCGGACGTTCTCGCGCTTGAGCGAGGCCAGCGTCTGGAAGATGTCGCCCGGGTCTGCTGTCACGAGGT
TGCCATAGACTACGACGACCTCTCGACTGCCATAGGCGGGCACTGTCTTCAACGAGCTCTTGGCGATCTCCAGCGCGTTCTGCAGCGACGGCTCCTTGTC
CACCGCTAGCGCCCCGGCGATGCGTTCCATGTGCGTCTTGGGGTTGCCCGACAGTTCGCTGAGCTTCTCGGCCGTCATGC