Description :
From Genome Similarity Track
Location :
Scaffold_737:7645- 12547
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_737-snap-gene-0.10Malonyl-CoA decarboxylase (MCD)
Pytiw_DAOMBR242034maker-piw_contig_737-fgenesh-gene-0.3EF hand-containing protein
Pytiw_DAOMBR242034maker-piw_contig_737-snap-gene-0.15Protein phosphatase PP2A regulatory subunit B

Sequence
4902 bases(100 bases per row)
AGTCATCTTTCCTGCAGAGCATCGACCTGAGCCACCCGAACGCCGCGGACCGCAAGAAGCTCTCCAAGCTCATCCAGGAGGTCGTCAAGACCAAGGCCAA
CACGGGCGGTACGTACCTGTGTGTCGTTCGTTATAAGGTGTAGAGCTCAGTGGCTTACGACATGTGTTGTTGCTGTATAATGTGCAATGTAATGTATGGA
AGACTTTGTGCCGCGCGTGGTGATCGCGAACCTCTGCGCCAAGTACCGGCAGCTCAACATCGAGGAGAAGAAGCAGTTCCTGCTCATCCTGGCGCGCGAC
CTGCACGTTGACACCGCTGTGGTATGTGTGATATGGATGTGTGTCTTGTAACATGTTTTATTATTTTAGGACAGATCCTAAAGTGTTGCTTATGCTGCTG
ACGATTCAAGCTCCAGCAAAGCCTCGAGTTTTTCAGCGAGAGCGTCGCGCGCGTGCAGCAGAAAGACAATGCGAGTGCGATCGACTGGCAACATGAGAAC
ATTGAGCGCTACCTGCGCACGTTCCGCAACTTACGCCAGGCGCTCAGTCCACTCTACGAGACGTTCTTCCAGCAGATCCTGTCGCAGCGTGAGGGTGGCA
TGCTCTTCCTCGTCCATCTGCGCGCTGACTTGCTGCAGGTGCTGCGGAAGCACACATCCGAGAGTGCTGAGGCCGCGGCTTTGCGGTCGCTGGACGTCAG
TCTCAAGGTGGGTGGCTGTTAACCTGAGCTGTTGTATGTTGGCTCGGAACATAATAACAACAATGTTGCCTGCTGTTGGTTGTGTGGATAGAATTTTCTG
GCCTCATGGTTCAGCGTGGGCTTCTTGAACCTCGAGCGCGTCACGTACGAGAAGTCGTCGGGCCAGCTGCTGGAGAAGATCATCCGGTATGAGGCTGTGC
ACCCTGTCGGGACGATCATCGAGCTCAAGAGGCGGCTGGGTACGATTCTCCTTGGAGGGAAGGAGCTGTTCTTTAGCTGCTCAGTCGTATTGAACTTGTG
TCTGTGGTGTGGGCTTTGACAGGCAAAGGACGGCGCTGCTTTGCATTCTTCCACCCCAGGTACATGTAAATTGCCCAGTATCGTATGGCCAATAGTTCGG
CTAACAAATTCTGACATTTCTTTGTTAGTGTCCCAGACGAGCCGCTCGTGTTCGTCCACGTCGCGCTGGTGAAGGAGATCGCGTCGAGCATGCAGTACAT
CCGCGACGAGACGGAGCTCATGGACGACGAGCACGACGCGAAGGCTGCGATCTTTTACTCAATCTCGTCCACGCAAAAGGGGCTTCAGGTATGTGTGGAA
ATTGGTTGTCTGTCATACAAATTGTGGATGACCTGGCTCATTCTAACTTGAGTCGTGTCTATGGAAATCAGGGCGTTGACCTGGGCAACTTTCTCATCAA
GGAAGTCGCGAAGGCGCTTAAGGCCGAGCACCACCAGCTCGACACGTTTGCGACGCTGAGTCCGATCCCACAGTTTGTCCCGTGGCTTGAAACTCAGCGC
AACAGTGTTGATGCCACGCTCGTAAGTGAGGCTCGCCTGGCAAAGCTCCAGTCGGCACTTTCTAACCACCACCAAGGAGCAGCAGCTCAGTCGCTGTTAG
TGAACCAGGTTCTGAGCGCACTCGCGATCGAAAACTGGTTTGAAGACGCCGAGCTGAGCGCCGCACTCAAGCCGATCCTGTTGAAACTGGGCGCGCACTA
CATTTTTTTGGAGAAGAAACGCGGCAAGGCGCTCTGTCCCGTGTCCAACTTCCACATCCGCAATGGCGCGATCTTCGAGCGCATCAACTGGCTCGCAGAC
CCGTCGCCAAAGGTGAGAAGCCTGCATATCAGCTATTGAAATTCTCTTGATTTCGGTTGCTTGGAAATGATGATTCTTAACATTGTCGAGCGACCATTTT
CATGATATTGTAACAGGGCCTCCACCAAAGCGCCGGCATGATGGTGAACTACAAGTACGACCTTAAGCAAGTGGAGGCGAACAACGAGAACTACTTGCTG
CAAAACATCATCCCGATCGGCGCGCAGCCGCAGCAGATCCTCGATCAGGTCTAGGATACCGCGCAATTTTCAGTTTGCTGGTACGCCTCAAGACTTTGGC
ATGTTGAGCGAATAAATGAGTTTGTTGATAGTTTTTATATTTTCGCCGAGACCTTTTCGAAAAGGCGTCTCCCATTTCAACGCCAGTCGAGGGACCGTGG
TTCGCCAATCCCCACAAGCGCAAGATGGTGCTCGCGCAGGACGAGATCGACGCGTGCCGCGAGGCCTTCCTCGCCTTTGACAAGGACCGGTGCGTTCGCA
TGAGTTGCTTGGGGATACGCAGCAGCAGGCTGGTTGTTTATCAACATCGTTGTTTCTGGCTTGCAGGAGCGGGACGATCGACGTGTGGGAGCTGCGCCAG
GTCTTGGAAGGTATGTAAACCTGCGTCTAGTGCTGCTGGTCTCTTGTGCTGACTCAGTTGGGTTCTGAACAACAGCGATGGGCCAGCAGCCGACGGAGGA
AGAGCTCTTCCAGATGATCAGCGAAGTGGACGAAGACATGAGCGGCGCCATCGGTGAGCACTTGTATATTATCATAAATATTTATTTATGTTGCTTGGGC
TAAATACTCAATGCTGTTTTGCTATTCATGCAGACTTTGCCGAGTTCCTCCAGGTGATCGACAACCAAAAGGACCGCGCGGCCATGTACGAGGACGACAG
CGACATGAGTGAGCAGTGCCTTCAAATGTTTTACTTTGTGATGTGATCTTTCGTCGAATGATCTTCTGCCCTTGTGGGATTATAAAGTCGACGCGTTCGT
GGCCTGCGGCGGCAAGACGGACAAGAGCGGCTTCGTGCGCAAGGAGACGCTCGTGAAGATCATCAAGGGCGACTTTGGGCTCACGATCAACATCGAGGTG
GCGAAATTTCGAGATTATTAACAACTCGCGCGGTCAATTCTCACTCACTCGCTGTGAATATCTTGCTTGTTTTATTATTTTATTAGGAGATGATCAACAA
ACTCGATGTCGACGGCAGCGGCGAGATCGAGTTCGACGAATTCAAGGCCATTCTCACGTGAGCGAGAGACAACTTGCCATTTTTTTTAGTAATATAACTT
GCAAACACTGCGGCCAGCCAGTCTTATGAGTTCGTGGTGCCTGTGGGTACTTCGCTACTATCTTCTCCATGGAGCAGCGAGAGTCCTTAATCCTATTTTC
AGTTTTGGTTTGTTTATATGTTATTTCCTTCTTGGAGTTTGTTGTCGCTCGTGGTGGCATGTTTGTTTTGTTTGTCGTTTGTGGGCTGGTCTGGAGCTGA
AACTTAGTCCGCTCTTTCGTGGGATCAGCCGCCTGTGCTCACATGCTATACACGTACAGATTGTTGCGGATCGAAACCGCGACCTCGCTCAGCGTCGGGT
GCCAGCTCGTCTGCAGCACCTTCCTGGAGAAATCCAATGCGTCCGTCTCGGCCGCTTGCGACGACCCAGGAGCTCCTCCAGCAGCTCCACCTCTGGTGAG
CTGCTGCGCAAGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTG
CGGCATCGAGTGGCGCCGAGGCGCGCGTGGTGTGGGTGACAGCGTAGTGTCGCTCCGGCCGTAGCGGTCATAAATATGGAACTCGCTGTTGTATGAGCCC
GTGATGAAGTTGTTCCCGTCGCCGCTCACCGCGCACTCGAACTTGTCAAATATGCAGTCGCTCTCGTACAGGTCGCCCAGACGCGGACGCAGATGCTCGT
GGATCTATTCGACATTGTTGGGAGGTAAACAATTTTTTTAGAAATTGGTTCTCGCCGACAGTTTTCACAAAAAATAATACTTACGTTGATCGTCTGCACG
GGTCGTGAGTCCATGTTGACGTCCCAGATCTTGAGCGTGAGGAAGTCGCGCGCGATGATGTAACGCCCGTCAGGAGAGAACTTGATGTCGGAGATCGACG
CAATGATCTCGGAGAAAAAGCTGCGCGCCTCGGGGTCTTCCTGTTCCTCGTAGACTAATAAATAAAATTTCAACAATGTCAAGAAAAAAATATATAGAAA
ATGTCGACGCCAATATTTGAGACCAGACCTTTGCAGTACGAGTCGCAGAGCGCGGCCTGACGCATGTCGCCGAGCTTGATCGCGCCGCGACTGGTGCTGT
ACATCATGATGTTGCAGTGCGACGGGTGGAAGTCCGCGGCCGTGATCACCTCGGTGAGCTCCTCCATGTTCTTCGGCTTGATGTCCACGATGTCTGTTAC
AACATATCGACGATTCTCAGCCACCCATATTATCATACAACCGACAAATGATGGACGAGGTAGGTCATTACGTACTGAAACTCTGGTCCGTGCGACAGAG
GCTCCAGAGGTTGACGCGCAGGTCGTCGGCCGACATGAAGGTCTCGCCGTCGCTGTTGAGCGCGATCGAGTTGATGTGGTACGTGTGCGCGTTGGCGTAC
ACGCGCTTGGCCGTGCTCGCGGTCACGCGGTTGCGCACCGAGCACTGCGGCAGGCGGATGCCGCTGGGGCAGATCACCTTGGCGCGACCACCGTTGTTAG
CCGAGGCGGCCGCGGCCGCGTTGTACTGCGTGACCTCGCGCACGTTGCGCTCGCAGACCTTCCAGAGCTTGATGGTCTTGTCGTTGGTCGAGAGCAGGTA
CTGCGCGTTGTTAGACGCACGGCCCCACTTGATCTGGTTGATCTTCTCCTCGATCTCGAGGCTCTTGAGGTAGTCGAACTCGGCGTTGTGGCTCTGGAAG
TC