Description :
From Genome Similarity Track
Location :
Scaffold_80:76437- 78065
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_12737para-aminobenzoate synthase, putative

Sequence
1628 bases(100 bases per row)
CTAGTATTAGCCGTCTATGGGGCTGGAAAAGTCGATGTCGCGAGCGGTCCAAGGGTAACTGCAACGACGTCGAACCAACATGGAGTACCAAAGGAGCAAT
CACGCATGCTCGCGCTATGCCGGAAGGCGTACGTACCAGCAAGTGCTCGTTGGGCGTGCGCTGCGCCGGTCGACCGCATCGAATATGTGCATGCTCTCGA
ACCCTTCGAGCGTCGTGAGCCAAGGCGGGGAGCGCATCCCTTGGTTCTTGCGATGATGACTCATCGTCGCAAAGGCCGCGTGATCGGTGCCAGTTCAATC
CTTGAACCCGCTCCACTCGTCAACACATGCAATGACAATAAGTGTCGGACATGGCACATCACCAACGAGAGCCGTCGAATAGAAGACCCACTTCAGCAGC
CAACGAGAGCCGTCGCACCCGTGCTCCTTGGCCGCGCCGAACGCAGTCGAGTTCCCACCGAGTTGAAGTGTCAGCGGTAGCCAATCACAGCGCGTGACGT
TTGCCTGCGGTCGATGCCATTGGCTACCCGAGACGGGCCGACAATGGAGCGCTGCGTCATTTTGCCAGTGACAAGCGACACGATGGTTGCTCCCCGCCGC
CGGCCGCCCGTGCTCACGCTCCTTCTTGACAACTACGACTCGTACACGTACAACCTGTACCAGATGCTCGCGCAGGTCAACGGCCTCGCGCCCGTCGTCC
TGCGCAACGACGCCTTCAACGGCGTCTGGTCCGACGCGTGGGCGTTCTTCCTCACGCAGGTCCCACCCCACGCCGCCATCAACATTGTGCTCTCGCCGGG
TCCCGGCCATCCGGCCAAGGTTGGCGACTTTGGGCTCTGCCACGCTGCGATTGTCGAGGCTCCTGCCGACGTGCCGCTGCTGGGCGTGTGCCTCGGGCAC
CAAGGCCTCGCGCATGCGTATGGCGGCGACGTGCGCCACGCGCCCAAGGTCATGCACGGCATCACGAGCTCCATCAATGTGACGCCGCTCGGGCGAGACG
GGCTTTTCTTTGGCACGGCGCCGACCTTCGACGTTGTCCGATACCACTCGCTGCTCGTGGCGTCGCTGCCCGACTGCCTCGTGGTCACTGCGTCGACGGC
CGAGGACGGGCTCATCATGGCGCTGCAGCACAAGGAGCGGCCGCAGTACGGTGTCCAGTTCCATCCCGAGTCTGTCTGCAGCGAGTTTGGCTACCAGCTG
CTCCAAAACTTTGCCGACCTCTCCAGTCAGACGCCGCTGAGCATGTGTACGCTTGCGCACGCAGCGACCGCGCCGGCGATGCTCGCTGCGACGCCAGTTG
CCAAGCCTGCTGCCGCCTACCACCTGCATACTACGGGTCTCGGCCAACTGCATCTCGACGGTGACGCGATCTTTGATGCGATTTACGCCTCGGCAACCCA
CGCCTTCTGGCTTGACAGCAGCAACGGAGCGCGCTACTCGTATATGGGCGACGCGGCGGGGCCGCTCAGCCAGCTCATCACGTACAATGTCGTGACCGAT
GCCACGCACGTCAATGGCGCGGCGATTGAGACGCCACTGTTTCCGTATCTGCAGTCGCAACTCGACCGCTATCGCGTGACGTCGGTGTCGTCACCGTTCG
ACTTCCGCGGTGGCTTTGTGGGTTTTTT