Description :
From Genome Similarity Track
Location :
Scaffold_20:764268- 765649
Transcript NameFunction/comments
Physo_132418hypothetical protein

Sequence
1381 bases(100 bases per row)
CCACAGCGATACCGACTCGGACTGTAAACGCTTGGACACTGATTCGAACTGCTTGAGGTCTTCCAGGAGGCCCTTGAGCTTTTGTGCACGCTGGAAGACG
GGAGCAGCTCCGCTACAGCATCGTCCTTGGGGTCAATGAACTCCAAAAGCCGCACGTAACGGTCGAGCATCGCAAAGGTGGAGTTCCAGCGAGTGTCGTT
GAGCAGCACAGAGCGAAGACTTGGCCGAGCGTCACTTCAGCATGGCGAGGTCGACTTTTGGCCTGGAGCGCCACTCGCTTTCGGCGCAGTCGAAGGAGAT
GATCCTCTTCTTAAAGGTAAACAGGTCTTACTGGGATGCCCAGTTAGTGCACGAAAGCATTTAGGTGTTTTAATCTAGAAGCAATTTAATGCATTATTGC
TTCGAGGGTCTCAGCATTTTCCATTATGTATGGTTCCTTGTTTGAGTTCTACATGCATTATTTATCTGGTGACTTCGGTGGCTAGTCCCTATTAATGCCA
TTTTCGGGAGGCCTGTTCGTGAGCGCGAGCACGTAGGCCCCGTACAGCAGCATTAGGCGAGCTGTGTATTGCCCATGAAGCAGACGCAATGCAGCATCGA
GATGGCGCCGTTCTCGGTCAGTGCCCCCACGCTCGCTTTGCCAATCCCGAGCGTAAGGTAGCGCCGCGTCTTCTCTACGCTGTCCTCGACGCTCACTTGG
TTGCCACACGGCAACGTCATTGCCAAGATCCCATCACCTCTGCATGTTGTCTGAGCGAAAAAATCTGACGGATGTCGTTTGAGTGAGCAGATAAATCGTT
TGTCATAGGTATATATACTTGATTACAGGGTATACAAAATAGTAGATCATTTGACTTAATCTCAACCGGATGGGTCAACATAACAGCATAATTTGATTAG
ATAGCAGACTATTTAGTATAACAGGTGACGTCAGGTGTAAAATTAAGAGCTTTCAAAACCATATTTTTTAACAGGTATTTGATGTGATAATAATGGCACC
TCAGTGGCCTTCGCCCATGGACTCTGGATAAAATCCAGAGAATTTAATTGACCAAACTACCATTTTATCGTTCATTTACGTGAACACCGACAGCAATTTG
CGCTTGTTGGGTCGTTGGAGTCGGTCTTGACCTTCCAGCTACGGTTCAAGACCACGCCAGGCTCGCTGTATCATCTCTATCCGCCTGCAAGTCTGATGAA
AGTGGCTAAATGCGGCAGTTTTACACTTATCGAGTAAGTACGAGAAACCTCTTTAGTTTTGTATGGTAACTTATTTGCGCGAAGAAGGAAATTCCGGAAG
ATTTCGGAAATAAGTTGGAACGGAATAAACCTAATCCTAATGAGCGACGATTGGATGAAAATAGGTAATTGAGCCTCAAAT