Description :
From Genome Similarity Track
Location :
Scaffold_117:76420- 78241
Transcript NameFunction/comments
Physo_109481glucose regulated protein /BiP

Sequence
1821 bases(100 bases per row)
CTGCTTGGCCTCGAAGTCCTCCTTGTCGGCCTCCTGGTTGTCCTCGAGCCAGTCCATGGCGTCCTGCACGGCGGTCAGAACGGTGTCCTTGTCGTCCTCG
TCGATCTTGTCCTCGAGCTTCTCCTCGACGTTGTTCTTCAGGCTGTACAGGTAGCCCTCCAGAGCGTTGCGGCCGTCGATGCGGTCCTTGACCTTCTTGT
CCTCGTCGGCGAACTCAGCGGCCTCCTGGACCATGCGGTCGATCTCCTCCTGGGACAGACGGCCCTTCTCGGCAGTGATCGTGATCGTCTCGGCCTTGCC
CGTGCCCTTGTCCTCAGCGGACACCTGCAGGATACCGTTGGCGTCGATCTCAAACGTCACCTCAATCTGGGGCACGCCACGCGGAGCAGGCGGCAGGCCA
GTCAGCTCGAACTTGCCCAGAAGACGGTTGTCCTTGGTCATGGCACGCTCACCCTCGAACACCTGGATCAGCACAGCGGGCTGGTTGTCCTGGTACGTCG
AGAAGGTCTGCGACTTCTTGGTCGGGATCACAGTGTTACGGTTGATCAGCTTGGTCATGACACCGCCCACGGTCTCAATACCCTGAGACAGAGGCACCAC
ATCGATCAGAAGCACGTCCTTGGTCAGGTCGTCCTGCTCGCCACTCAGGATGCCGCCCTGCACGGCAGCACCGTAGGCGACGGCCTCATCGGGGTTCACA
CCGCGCGAGGGCTCCTTGCCGTTGAAGTAGTCCTTGATCAGCTGCTGCACCTTGGGGATACGGGTGGAACCGCCCACCAACACAATCTCATCGACCTCCG
ACTTCTTGAGGTCGGCGTCCTTCATCACCTTCTCGACGGGGCCGAGCGTCTTCTTGAACAGGTCCTCGTTGAGCTTCTCGAAACGGGCGCGGCTCAGGGA
CTCCGTGAAGTCCTCGCCATCCAGCAGCGACTCGATCTCAAGACGAGCCTGGGCCTGGGCCGACAGGGCACGCTTGACACGCTCGGCCTCACGGCGGAGC
TTCTGCAGGGCGCGCTTGTCCGAGGCGACATCGAGGTTCTTGTCCTTCTTCCACTTCTTGATGAAGTACTGCATGATACGCTGGTCGAAGTCCTCACCGC
CCAGGTGGGTGTCACCGTTGGTGGCCAGCACCTCGAACACACCGCCGTCGATGGCCAGCAGGGTCACATCGAAGGTACCTCCACCCAGGTCGAAGACCAG
CACGTTCTTCTCGCCCTGCGACTTCTTGTCAATGCCGTAGGCAATGGCGGCGGCCGTGGGCTCGTTGATGATACGCTGCACCGTGAGGCCGGCAATGGTA
CCGGCATCCTTGGTGGCCTGACGCTGGGCGTCGTTGAAGTAGGCGGGCACCGTCACGACGGCGTCGTACACCTCGCGGCCGATGTAGCCCTCCGAAATCT
GCTTCATCTTGGTGAGCACCATGGCCGAGACCTCCTCGGGGGCGAACTGGCGCTTCTCGCCCTTGACCTCCACCTGGATGAAGGGCTTGCCATCCTTGTT
CACGAGCTCGTAGGGCAGCAGCTTCTTGTCGGCCTGCACCGACTTGTCGTTGTACTTGCGGCCGATGAGACGCTTGACGTCGAACAGCGTCTTCTCCGGG
TTGATCGTGGCCTGGTTCTTGGCGCCGTCACCGATCAGGCGCTCGTCGTTCGAGTCCCAGGCGACGTACGAGGGTGTGATACGGTTGCCCTGGTCGTTGG
CAATGATCTCGACCTTCTGGTCCTTGTAGATGCCCACGCACGAGTAGGTCGTGCCCAGGTCAATGCCGATCACGGGGCCGCGCGGGCCCTTGGACGCGTC
GTCGGCCGTTACGGCGCCGGC