Description :
From Genome Similarity Track
Location :
Scaffold_1330:764- 4908
Sequence
4144 bases(100 bases per row)
CACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAATGTCGAATCGATAACGCTCTCTATGGATTC
ACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTAGGCAGGAGTGCCGGAACCCCGTCGGTGTTAGGACGC
AGATCTTACATCGACGACATTCTAATCCCGGCAAAATCGTGGGATCAGTTGTGCGAAAGAGTGACAACCCTACTGGAGGCGTGTACTAAGTGGAATCTCT
CCATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCATTC
TTCGTTAGCCGATTTGCCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTAAGCCCTG
TTGGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTCGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAGCAAGCTCTGGCCCGGGAGATGT
CGGATCCACGAAGGAATCCAAGTGGTACGACGCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACGGAGAGAGGATCCAGTCTGGAT
AGAGACGACGGATCAGAACATAAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCC
TCCGTCATTTTGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTGCAAGAACATGAGGGGATCTGTCA
TCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAAT
TACAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGT
GGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGC
TAAGATGGATGAGGCGCTGACTAGGATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTGTAC
GTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGGGCATACAGTGCAATACTGTGGAGACTACCCGGATGGGAAGTTGTACGGGCCAGAT
CCACTTACGCGGAAGGCCTCACGGTCAATGAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAATATCCAAAACGGCTGGTGAT
TTGTGGGGATTTAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTG
CGTGGTAGGTTGAATCACGAGTTGGTGCACGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGTGCCGCTTAACGGAATCAATGTGGTGTCG
AAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGATACGTTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCGGGAAAGGGACAGCCCAGGTGATGGC
TGTCACTAGGTCCAGAGGAAGGATTGGATCCAAGCCCCATATCCTCGAGAAAACATTCGTGAAGGAGTTCGCATCGAGCGGATCATCAAAGCACAGAACG
AGGAAGCATGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGATACCAAATCCTACAGTATTATCGCTACGGATTA
CGCAGTGGATATGACTGACTTGCTCTTCTATTGCCCCCTACGAAGAGAGTCAACGAGGATTGGGATGGATTGATGAGACTAGTGATGCCAGAACCCTTAC
AGCAGGATGTCCTACACCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTGGAGGGG
GCTATTCAAGAGCGTTCAACGATATGTCGGTGAATGTGTGGATTGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATGTCCAAGCGACTTCC
CCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTAAACCGGATATG
TGATAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATGGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGGGCTAGTGAGATGATTAGACA
TGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCTTTCAACCGGATCCTGGGGCAGAGACAGCGGGCAACCATGGCATATCGTCTCCAAGCTAAC
GGGTCGGCCGAGCGCATGGTGCAGACGATCACGAGGGCACTCAAGAAGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACCCC
CCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCATTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCA
GTATGCAGCACCAAGAAGAGAAACCGATATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGCACGAACGACTGC
GGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAA
AGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCATGGACCGCTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAGGCTGGAAACGGCAGGTACC
GAATATCGCCTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCGATC
GCGTCGACTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCGGG
TAAACGAACTAGATACGGACGGGTTTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGA
GCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGGGAACCATGGATGTGAG
TTGGTCATGTCGATGGGAGGATGAAGAAGAGCCCACAGGAAGGGTTTGGGCCAGGAGGAGGAGGATCGCTGATGTGAGTTGGTCACATCTGAAAGAAAGA
GAAGACGAATCCACAGGAAAAGGGTGGATTAGGAGGAAGGAGTGAAAGTTTATGCATAAGAGTGACGTTTTACGTGCGAGGAGTCCTGTTTGATCTCAAG
CACGAGCTTTCAAGGGCCCCAACTATACTGACCCAATTGATCCTGGGTCATTGGCGCTAGATCCGGATGAAATCCAGGCGCAGATCCAACCGGATCCGGG
ATCCCGCCCAAATCCAGGTGTACACTGATAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGA
AAGGCCCGGACTCGATTTCTCAACCAACGAGGGAATGTTATAGACATATTCAATTAAGAGAGTGTGGATTATGATAGCTTATGCAAAGGGCTAGCTCGAC
CCAGTTTCCAGTCGCTAGTTACGGCTACGAAATGAATCCACGAAGACTGAAACTGAAGGCGTGACGTCAAAGAGGGATGAGGATCAGGTAGTCTTGGGCT
GAACGTTGAAGAACTTGCCCACTAGACGCTGGATCTGGCGTCCT