Description :
From Genome Similarity Track
Location :
Scaffold_3066:764- 2178
Transcript NameFunction/comments
Phyta_totarag15045hypothetical protein

Sequence
1414 bases(100 bases per row)
ATCATTCTCGACAGGGTGCCAATATTCGGGTGCACACCCGATCAGACCGATAGGGTACCGGTATTTCGGTACATTGCGATCGGATCGGCAATGGAACAAG
GATGTGATCATTTCGACACAGGTACCGCGATCTAGGTACAATTTTTTTTGGGAGCCAGTGTGTGCCACGATTGGCTGATGCGCAAGCAGAATAGGAGAGG
AGTAGCTTGCATGTTTTACTTTGGTTTGTACAGCCTTCGAATTACCTTCTAAGCTGCAAGTGGTGACCTGATTCCGGGCTGGGAAGTACATTGGGCCCCC
CGATGACAAGGTTCTGCTAAAGCGACTGCAGAgagaacacgaagaagatccGCTGGATAGCGTGGCCAGGAGCGATCAGATCTCACCCTCAAGACTCCCC
GTCAAGAGTAGGCGGAAAGCAAAGGAAAGGCAAGGATACCCACACTGGTTGGTCGCATCTCCCAAGACACGATCAACCCCACCGACGGCCAACTGAAGAT
TTCCAAGTGGCGGTCAAccaacccccccccccccccccttaCCGTCCATACCAGTTTACCAGCGATCTACCAGACGTCTTCGCCGAGCATCGGAAGAGCG
TAACCCGCCCAACCAACGAGTACACAAGGTGATAAGAAGCTTCAGCGTCACACGAAAAAgcggagtaccccctccgtaAGTTGGTAGTCCAGGCAACCGT
TTTCTAGCTTGGATCGCGTCAGCAATTTAGTGGTACCGGCTTTGCCACaatggtgcgcgtgcccggatCTACTGGTGACTAACAGGGATTTCACGGTGAG
TCCGACCAAGAAGATGTCAAGATCAAGGTTGAACCGGGGATTGGTGCGCCGACGGAAGGTGAatcgccgtcgccgcagCTGAAGGAAGAAGGATACGCCG
ATCTTCAGAGTCCTGGGAGGAGCTCCGACGACGTAAAGGAGGAAAGTCTAGCAATGGACCTGGAAGAGAAGCCTCACCCTCCTCCCCAGGCCCCTCCGGG
GGCCCTCGCGGATCGCGATGAGAATCGTGATCCGCATGATGAAGATTCATCGGTGAGAACCGAGGGACCTTCAGCCTCGCACACGTCCTCGAAGACAAAG
ACTGCTCGAGCGAAGCTGAAGGCCCCGGGATACGACGCTGACGTCGATGACCCGAAGGGACTGGACACCTGGTCTGACGATCAGCTGGAGACTGTTTTCT
ACCGGAAGGAGCCGTACGCACTGCTGATCGAAGACCCAGTGTTGAAGATCATGCGGCTGAAGTTGATCGGAGACCTCCGAGGTTCGATGACTGCGCCCAA
GGAGGCGCGAAACAAGCTGGAGGCAGCGAAGCTTCTTATGCGCATGTTGAAGGAAGCAGGGATCGTGCAGAGAGCGTTCGATGCGAACACGTTGTTCGAT
CTGGAACTGATGGT