Description :
From Genome Similarity Track
Location :
Scaffold_91:76372- 80321
Transcript NameFunction/comments
Aphas_H257_16318ABC transporter lipid export ABCA family

Sequence
3949 bases(100 bases per row)
GAGAAGGAGACCAAGTCCCGCGAACTGCTCAAGATCATGGGCGTCTCCGAACGTGCGATCGTGCTGTCGTGGTACGCCACGTACGGCGGGGTGTTCTTGG
CGGCGGCAGTGTTGCAGGCGGCGGCCGGGAGCGTCAACCTCTTCCCCAACACGAACGTGCTCCTGTCGTTCGTGTTCTTCTTTGTGTTTGGGCTGGCCGT
GCTCAGCTACGGGTTTATGGTGAGCGCGCTCTTCTCGAAGGCCCGCACAGGCGCGTACGTTGGCATCATCGGCTTCTTCGGCATGTACCTCGTCTCAGCC
GCGTTCACCCCCGACACGGACGAACGGGTCAAGACATGGAGCTGCCTCTTGGCCCCCGTCGCGCTGAGCTTTGGCACGTCGGCGCTCGCGAGTGCCGAGA
CCAACTCGCTCGGCCTATCGTTTGCAAATGCCAGCGATCCATTCAACAACTTTCGATTTGCCACGTCGTTATGGATGCTCGCGGTGGACGTGGTGTTGTA
CACGCTCTTGGGCATGTACTTTGAGCTGGTGGTCCCGAAAGAGTATGGGGTGCCGCTGCCGTGGCACTTTCCGTGCACGTTCTGGATGAAGTCGCGCCAG
GCGCCGCCATCGACTTATGCGTTGGCCGATACGCATGACAACGACAAGGACGTTCCCATGGAAGACATGGGCTTGGACATGCGGCTACAAGAAACGTCGG
GCGACGCCCTTTCCATTCAAAACTTGCGCAAAGTGTTTGCCGTGCCTGGTGGAGTAAAGGTCGCGGTGAAAGGTATCAACTTAACCATGTACAAGAACCA
GATCACGTGCTTATTGGGGCACAACGGCGCCGGCAAGACAACGCTGATCTCCATGCTGACGGGTATGATTCCAGCGACGAGCGGCGACGCCACCGTCCAC
GGTCTGTCGCTGCGACGGGACCTGCCAACCATCCGCCGTTCGCTGGGCATGTGTCCGCAGCACGATGTTCTGTACGGCGAACTCACGGTACACGAACACT
TGTCGTTCTACGGTCAGGTCAAGGGGTACCGAGGCGCCGACCTCGACGCTCAAGTAGACGCCAAAATCGTCGAAGTGGGGCTGACGGAGAAGCGTCAGGT
CAAGGCCAGCGACTTGTCGGGGGGGATGAAGCGCAAGTTGAGTCTAGCGATTGCGTTGCTGGGCGACAGTCAGGTGGTATTTCTGGACGAGCCGACGTCT
GGCATGGACCCGTACAGCCGTCGCAGCAGTTGGGAAATCATCCTCAACAACCGATACAACCGCATCATCGTGTTGACCACGCACTTTATGGACGAAGCCG
ACATCTTGGGCGACCGCATTGCTATCATGGCGGAAGGGGAGCTGCGATGCTGTGGGTCGTCCTTGTTCCTCAAGAATAGGTATGGCGCCGGCTACAACTT
TTCGCTCGTCAAGACGGACGACTGCGACACGGATGCGCTGATGGCGTTCGTGCGATCCCACGTCGACACTGCCAAAGTGCTCAGCAACGTGGGCACAGAA
GTGTCGTTTCAGCTCCCATTAGACTGCTCGCACTTGTTTGCGCCTATGTTTGTCGAGCTGGATGCCAACTTGGCTCATTTGGGTGTGCTCTCGTACGGCA
TTTCTGTGACAACGTTGGAAGAAGTGTTCATCAAGGTGGCCGAGCTGGGCGACGTGGGCCAGCAGCACACTCTGCAACCTCGGAATGACCACGTGGCAGC
AGTCAAGCCCGAACCGTTTGCGCTGCAGACGCCCCGGTTCGCAGATCACTTTCGCGCGCTGTTTCTAAAGCGGTTCCGCACCGCCAGACGGGACAAGCGC
ATGGTGCTGTTCGGGGCGCTTCTGCCGGTTGTGTTTTTGACGCTGGGGGTGCTCCTGCTCAACTACAGCTCCCTGACCAAGAACGACATGGCGATGGCGG
TCAACACGGACGGATATCCCCAACAACGAGGCGCGACGCCGTACTTTTGCGCGGGGGGCCGCTGCAGCGACATCTTTGCCAACATTGCCAATGGAAAGCG
ACTGGACATTGCCCTGCCAGTCTATACATCGTCGACGCCGACCGTGTTCAACGTCACGTACACCAACCCGAGCATCAACGAGACCGACACGACGGGTTTC
TGCCTGCGAGCGGCCGAAGAAGCGTTCCGCGAAGCCTACAACAGCAACAACAACCTCGTCCAGTTTGGCGGGTTTGTGGCCCAATCTGATCCCGCGGTCA
ACGTGTTTGGGTACAACGTCATGGTCAATACGACCGCCACGCACTCGGCCATTGTGTACAAAGCCATGCTAGACCACGCGTTGGTGCAGTCGTTGTCGTC
GTCATCGTCGGCATCATCATCTAGCCCCGTGTTTTTAAGAGTCACGAGCCACCCGCTGCCGCTCACGTCGGCGTCCAAGCTGCTCTTTACGACGTTTCTG
TCGTTCATTGCGACCATTTTCATCGCGATTGCGTTTGCATTCTTCACAGCGTCAATCGTGCCGTACCTCGTCCACGAGAAGCACCCGACGCACAACTCCA
AGCACCAACAGTTGGTCAGTGGCGTGAGTTTGCCGGCGTTCTGGCTCGCCACGTACGCGTGGGACCTGCTGTTTTACGCGATTCCGGGCGGCTTTGGCCT
GGGGGTGATCTACTTGTTTGAGATTACTCCGTTCACGGGCAAAGACTGCGCCACGTGCACGTCGCAGCCGTTTGCGGCCGTGGCGGTCGTATTTGTACTG
TTTGGGTTTGCGCTCTGCTCGTTCTGCTACTGCCTGTCGTATTTGTTTGTCGACAGCGCGTCGTCGCAGACGTACGTGATCATGGTCAACATATTTTTGG
GCGTGGTGTTGATGACAATATCGCAAGTGCTCGACGTGGTGGCCAGCACGACCGAGATCAACAAGGTACGGGGGGTGCTTTATATGCGTCATGCTGACCA
TAATGATGATGATGATGGGGGTCGTGATGTTTATAGTCGCTCAAGTTTATCTGGCGGCTGTCGCCGCTGTTCAATCTGGGCAATGCGCTCAACAACTTGA
GTGTCCAGAGTCTCCTCAACAGTTTGTTCTCGTCGACCAGCACCAAGAGCTCGTTCGACCTGGATGTGACGGGGTGGGAGATTGCATTCTTGGCGGGGGA
AGCCGTCGTGTTTCCCCTTGTCGCAATTGGCATTGACTACGCCCTGAGCTTCCCCAAGATCAAGGCCATGATCGCAAAGGACCCCGTGGTGATGTCCGCC
CCCATGACCATCGACGACGACGTGGCGGCAGAAGGGCGCCGCGTGGCTGGCGGAGACGTGGATGACTACGCAGTGGTCATGCAGCACCTGCGCAAGGTGT
ACAAGGGCGGAAAGGTGGGTCTGAACGACCTGACGCTGGCTCTGCCCAAAGGCGAGTGCTTTGGCTACCTCGGGATCAACGGCGCCGGCAAGACGTCCAC
GATGAAGATCCTCACGGGGGACGTGCTGCCGACGTCTGGCTCGGCAACCCTCGGGGGGTTTGACATCATGTCGCAGCAGATCGAAGTGCGTCGGCTGATC
GGGTACTGCCCACAGTTTGACGCACTGATCGACCTGCTGACCGTTCGTGAACACTTGGAACTGTTTGCGTCCATCAAGGGCGTGCCATCCAAACGCATCT
GCGACACGGTCAAGGACAAAATGGACCAGATGAACTTGAACGACTTTGAGCACAAGTTGGCCGGGACGTTGAGCGGCGGCAACAAGCGCAAGCTGTCGGT
GGCGATCGCTCTGATTGGGTCGCCCCCGATCATCTTCTTGGACGAACCATCCACGGGCATGGACCCCGTGTCCCGTCGGTTCATGTGGGATGTCATTGCC
GACATTTCCACGCGCAGCAAAGAGTCGACGATTCTGCTGACCACGCACAGCATGGAGGAGTGCGAGGCGCTGTGCAGCCGCGTGGGTATCATGGTGGGCG
GGTCGTTGAGCTGCCTTGGCAGCATCCAGCACCTGAAGAACCGCTTTGG