Description :
From Genome Similarity Track
Location :
Scaffold_1368:7636- 8726
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1368-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
1090 bases(100 bases per row)
TCGTGGAGCTCAGGAACCAAGTGGTTGTCAAGGTCGGCTTTGAACTGTACAAACTGGCTCAGAACCACAGTTTGCTGTGCATACATACGAGAGATAAACA
GACCGAAGTGCGATATCAGTCAATACACAAAGGAGCCATGGATCAATGTAAAGAACGAGCGGTGCCGGGAGATCGTACCTGCTCGACTGAGAGCGTCGCG
TTTGGCTGTAGCTGCGGTCGCAGGTTCACGAGCTCGTCGCAGAAAAGCTGGTCGAAGCGCTGCACGAGCCGCTGCAGAAACGCCTTGAACGCAGCTGCGA
GCGGCTCCGAGACCGTGCGGTCGTGGAAGAGCACGGCCTGCACGGCCTCGGTCTGCGTCGAGATCATCGTGATCGCACCGGCAGTCGACTGTCCGCAGCA
AGCAAAATGCGTTAAGGTTATCACGCCAAGTACGCCTCACAAGCTTGCTGGAAGAGTACATGGCGCTCACCATGAATTGCATGGGGCCGCTGCTCGGCCG
TCGGTCGTCCGCGAACTTTGGGTCGTTCGTGAGACTGGACGGGTTAAAGTGCACCTGCATCACCTCTGCGCACACGGCATATCATATATTGGTCAGTACA
CACGCGTCTGCAGCACACACATGAGCATTCATACGCACCGCCGCCGTCGATCTCGCGCGCGAACTGCGTGAAGGACTGCACGAGCGCGTCGACACCCTCG
GGGTGCGCGTGCGGGTTCCACTTCCACTGCTCTGTGAAGAGGCAGACGCCCGACTGGCGGTCCAGCAGCTTGAGCATGCGTAGCTCGGGCACGGCCTGCA
GAGGCGCTGGAGCCCCCGCCAGCAGGGGCGGCGGCATAGCGCCCGCCAGCATGTTGCTGTTCATCACATTCGCCATATTAAGCCCCAGCCAAACTGGCGT
CTTCTTTCTTTTGTCAAGGTTGTTTAAAACTACCCTGAGCGTGATATCTATACGGTCACCAAACTGTACTTTAAACGAAATATGTATACCTCCGTCTATT
TTGCCAGCATTTTAGACCTCCCAGTGGTACAGTACAGGTAGAGTTATAGCATGATGACCGGCGAGTTTGGAGCTCTCCGAGTCTCGCTCA