Description :
From Genome Similarity Track
Location :
Scaffold_23:76349- 77510
Transcript NameFunction/comments
Phymu_g1516hypothetical protein

Sequence
1161 bases(100 bases per row)
TTGCAGTTGGTGATCAAGAAGCTTCTGGTGTAGCACTGAGTCTGCAGACGGTGGATGTCAATaaggtggtgaaggaagGGGCACCTTTGCTGcgcagtgg
aggagaagtACGTTACACGTAAAAGGTGGCAATAATGATGACGAAATTGAGGGAGATTCATTGCTGTTATAGGAGTACCAGTACGCAACAAACTTGTCGG
AGGAAGAGCGGCGCGTGTATGCGGTGAAGCAGCGGCGTTTATTGCTGAAACGCTTGAGTGGAGCGGGAGGACCCATCTGGAAAACGCGTGAGGACTCACT
GACAAAGCAGCTTCTACCACGGCTCAACCGAGATCGTACGTAGAGCTACAGCGTAGTTGACACCGCTCTTTttttgggggggggggttgAACTGATTTTT
GTGGATATATTGAAGATGCGCAGGAAATTGCTGATGATATTGTGGCTAGTGATATACATCCTAGTGCTGAAGAGGAACTTGTTGCAACTACCAGCCGAAA
ACAAGCGAGTGAAATGTTATCTATCCCAACACGATCCAAACGGCGCTATGTTGATGACACCACGAAGTCGAGAAGCGACGGAAAGCGGGTGAAAATTGCT
CATGAAGCCGACGTGGATATGAAATCTGAAGGTGATGATTCGGTGGACAAGGACTGTAAACCACAAACGAAGGCAATACTTGTTGCAGGTCTAGTCTCTG
ATCTACTGGAGAGTATGTTTGATTCCAAGTGGGAAGTTCGTCACGGGGCCCTCTTGTCGTTGCGGCAAGTACTCCTGGCTGCTCAATTCACAGCTGCAGT
TGATGCAGATCGGCCTATGATgaacaagacgcagcagcgaagtTTCATTGACAAGTGGTTAGAGGAATGCTTGATTCGGTGCATCTGTGTGCTAGCACTG
GATCAATTTGTGGACTACTCAGCAGACGGTTCCGTATCTCCTGTACGCGAGGTCTGCGCCCAAGTTTTTGGTATTTTTTTGGGCAGTCTTTCGAGTGAAG
ATATGCTTGTTGGATATCTGCAAGTAGTGCGAACATTGTTCAGTGGATCAACGTGGCAGGCTTGTCACGGTGGATTGCTAGGGCTGAAATATTTGGTTCG
AGCTCATAGCAATCATGCCCAAGCGCTGGTCCCCCTCTTTTTTGACGATATTGTGACTGCG