Description :
From Genome Similarity Track
Location :
scaffold_65:76326- 77519
Sequence
1193 bases(100 bases per row)
GCTCCGTACGTTAATAAACAACGATCCTGGATTTCTCAGGATTTTCCACACCAAGCCCATctagtgtgacacacacccctgttaccagggagCTTGATAT
TGTTAATCGACAACCAGGTTAACTCTCGTGAAGCAAGTCGATCACTGAAGGAAGAAATTTCACTGTCTCCATCCTGTTGAGATACAATATACCCGTCTTT
TCCTTAGAAAGCCTCTCTGCATCAACATTTTAAGTGACAAGCTCATTGGTTGACCCGCGCGTGTCGACTTGAACCTTTGCACCTCTCAACTAAGGGAAAA
GGGAAAACACAGAGTGCAGGTGTTCAATACTACCACAGAAGTTGCATCTACAGGTATGACGATGCTGCGCAACAGCTTTCTCAGCATGACTACCTCTGGT
GCGCTTGCAGAGCTTCTACCACACAAACCTATCCCAGTCCTATCCCAATCTTTGGGACACAGGCCTTGCGGCTCGAAATCAATGCGATCCCCCACGACGT
TCAAGGGGACGTGAATAGTCTTGCTGTGAGTCGCACCTATTTGTGGGCCCTCTGTGTAGAAGGTAATTGTTACCGTTTTCGGGTGAGAGTCTGCCGTAAT
GCCGACAAAAGTTGTCTAAATAATCAAGCGGACTCCGCCGATTCTACCGTGCCTTGTTGTGTGAGCTTGAATTTTGATCGTACAAACAACGCACGGTTAG
GCGTAAGTAACAGCCACCACATCTGTTGCTAAACGCTTTTCATACCGGAAGCGCCGAAGTCCTCTTCTACAGAGGCATTGCACCTAAGTACCTATCAAAG
ACCGCCAGCACAATGCACTGATACTCTGCAAAATCTTCCAACCAAAAGATAGGGTTTCTCGGTCTCTGCCCACCAGAAGGCTTGACGTTAAGTCAAAGCG
GCTTCACTCTATTGAGCTATGTGGACTGCGACTTCATGAAATCACTTCTGACCAAGCTCATCGCCAGCATTTTAAGTCGGTCGAAACAAGGAAAGTTTTC
ATGCACAAGCAAAGTAATAAGGTGCAGCATTCATCGAATTTTGCCCTGTTTGGGGCGACGGAAGGAAAATTTTGTACTAATGAAAAAGATCAGTTCCTAC
TAGTATCACTCAGGATGAGAGAAATATCAATCGCTTTAAGGTAAACGTAGCGGTGAATATAGCACCAAAAGACAATGTAGATAATCTCAACTC