Description :
From Genome Similarity Track
Location :
contig_24:763231- 765183
Transcript NameFunction/comments
g5816.t1hypothetical protein
g5817.t1RAW38737.1 hypothetical protein PC110_g5040 [Phytophthora cactorum

Sequence
1952 bases(100 bases per row)
TGCCAGTGCCAGCCATCCTTCTTGTAGTCCGAGACCTCCAACGTGTTGTAGAACAGCAGCGAGCCGCCTACCAAGCAAACATTCAACAGTGAAGACGAGC
GCATCATCGCAACATGGCGTTAGGCCTGCACAATTAAGTAGCGCGACCAACGCGACGGGAGACCTACTTGGCGGCCGCAGCTGCAGCGAGTGGAGCACCG
GCACGCCCACCAGCTTGCAGTGCAGCAACAAGAACACTAACTCGTCCTTCACGAGCCAGCGCCGCGTCGCTTCCTCGCGCAGAGAGGCCGCGCGCGCCTG
GATGCCATCGCCCAAATTCATTCGCCGCCGTAACGTCGTCTGGCGCCTTGGCTTCAAGAGACGACGAGTACCGTGAGTTTCATGATTATGTCCGTCGCAG
TGTCGCAAAACAGGAGCAAGTCATCGAGGTCGGCTGCAGTTTGCTCCTGGCTGTTTAGGCTCTAGCTTACATGTACTTTGCTCCGTTTCCAAGGGTAGTC
TCTATGTGGTGTACGCGGCCTGGAGCCACGCCGCCAAAATGCGCCATTTGCGCGGCAGTGCGCTGCTTCTTGCTGCGCATTTTCATCGTGTGCCAAGCCA
CGCGCTCTGGGTCCTTGAAGTCGGCCACCTGCCAGACCACGCCCGGGACTCGGATGAGCTTCGCCCTCGTGGGGGCTGGCGTGTTAGCGAAGAGCTGTTG
GTACATTGAAATGGTCGAGACTTCTTCGTCACCTCCGGCGGGCCCAATGCCCTCCACTTCCAGTCGCAGCGCGTCGCCCATGAGCGCAAACCCGATCTTG
GTCAGTTGTTGCAAGTTCCACAGCGCCAGAGTGTTCCACGGCGACGTCAAGCCGCTCAGCTCCAGTGGTTGTACTGCAGGGTCGGGTTGGAAGGCGTGCC
CGGGCAGTGCCGTGCCCACGACGAGATCATGTTCAGGATCGAAGTTTGAGCGTAGCAACGCCACTCCAGCAGCATCGACCTCGATTTCCAGAGACTGCAG
TAGCAGCGTGTCAGCGTCGGGGAAGTGGTCAGCCGCTGTGCCCACCAGAGCATTCAGTGCCGGCACAAACTTGCCCCAGTAGAGCATTGGAACAATCTCC
ACCTTGCCGGCGAGCAAGCCCGTCGCCACTTCGTTCTGTAGCTCCGTCATGAACTCGCGCACTGAATCAACAAAGGCGCTTGTGATTTGGGAGGATGTTG
GCGAGATCGAGTCGGCAGCGCCCGAGGCAGGTGCTCCGGTGATCGTTGTGGCAGTCGCAGCTGGCTGCCCCACAGCGATGAGGATGCCGCCATCCGCGTA
CGTCGCTGCACGGGCGCAGAACTCGCGCAGTTGACGCAACAACTTGTCAACGTCTACCCGCTCGTACTGGGTGTGACTTTGCCAGTGGAGCCGCGTGCCC
ACCACCGTCGTGCCCGTCATGCTGTTGCAGTGTCGAGTGCTGCTTGGCGAGTGTCATGGAAATGCGTCACATCGCGCGGTATCAGATTCAGAAACGGACA
TCGAGGTCCTGCTTGTATTGTATTTCACGGATGGTGGTTGAAAAGCTAAATGGGTAGACCCAACTTTCAGCTTCACGCCTCCAGGTGATGCACACGTCCA
GGTGCTACGCCAAAGTGAGCGATTTGAGCTGCTGCGCGTTGCAGTTTGCTCGCCATCTTCTTCTGATGCCACTCGAGCCGTTTAGGGTCCTCCAGTCCGT
CCACTTGCCACGCGATGCTGGGCACACGCACCAACTTCGCTGTTGTGGGCGACGTGCTGTTCGCGTAGAGCTGCTGGTACATGGCGATGGTGGCGACCTC
TTCAATGCCCGCAGCAGAGCCGATTCCATCGACCTCGAGACGCAATGCATCGCCCATCAGAGCGAAGCCCACCTTCGTCAGCTGCTCCAGATTCCAGAGC
GCGAGCGTGTTCCACGGAGATGTCAAGCCGCTTAGCTCGACCGGTTGGGTCG