Description :
From Genome Similarity Track
Location :
contig_24:763226- 765178
Transcript NameFunction/comments
g5534.t1hypothetical protein
g5535.t1hypothetical protein

Sequence
1952 bases(100 bases per row)
CGCTCTTGTCCTTGCGCTTCTGCCAGTGCCAGCCATCCTTCTTGTAGTCCGAGACCTCCAACGTGTTGTAGAACAGCAGCGAGCCGCCTACCAAGCAAAC
ATTCAACAGTGAAGACGAGCGCATCATCGCAACATGGCGTTAGGCCTGCACAATTAAGTAGCGCGACCAACGCGACGGGAGACCTACTTGGCGGCCGCAG
CTGCAGCGAGTGGAGCACCGGCACGCCCACCAGCTTGCAGTGCAGCAACAAGAACACTAACTCGTCCTTCACGAGCCAGCGCCGCGTCGCTTCCTCGCGC
AGAGAGGCCGCGCGCGCCTGGATGCCATCGCCCAAATTCATTCGCCGCCGTAACGTCGTCTGGCGCCTTGGCTTCAAGAGACGACGAGTACCGTGAGTTT
CATGATTATGTCCGTCGCAGTGTCGCAAAACAGGAGCAAGTCATCGAGGTCGGCTGCAGTTTGCTCCTGGCTGTTTAGGCTCTAGCTTACATGTACTTTG
CTCCGTTTCCAAGGGTAGTCTCTATGTGGTGTACGCGGCCTGGAGCCACGCCGCCAAAATGCGCCATTTGCGCGGCAGTGCGCTGCTTCTTGCTGCGCAT
TTTCATCGTGTGCCAAGCCACGCGCTCTGGGTCCTTGAAGTCGGCCACCTGCCAGACCACGCCCGGGACTCGGATGAGCTTCGCCCTCGTGGGGGCTGGC
GTGTTAGCGAAGAGCTGTTGGTACATTGAAATGGTCGAGACTTCTTCGTCACCTCCGGCGGGCCCAATGCCCTCCACTTCCAGTCGCAGCGCGTCGCCCA
TGAGCGCAAACCCGATCTTGGTCAGTTGTTGCAAGTTCCACAGCGCCAGAGTGTTCCACGGCGACGTCAAGCCGCTCAGCTCCAGTGGTTGTACTGCAGG
GTCGGGTTGGAAGGCGTGCCCGGGCAGTGCCGTGCCCACGACGAGATCATGTTCAGGATCGAAGTTTGAGCGTAGCAACGCCACTCCAGCAGCATCGACC
TCGATTTCCAGAGACTGCAGTAGCAGCGTGTCAGCGTCGGGGAAGTGGTCAGCCGCTGTGCCCACCAGAGCATTCAGTGCCGGCACAAACTTGCCCCAGT
AGAGCATTGGAACAATCTCCACCTTGCCGGCGAGCAAGCCCGTCGCCACTTCGTTCTGTAGCTCCGTCATGAACTCGCGCACTGAATCAACAAAGGCGCT
TGTGATTTGGGAGGATGTTGGCGAGATCGAGTCGGCAGCGCCCGAGGCAGGTGCTCCGGTGATCGTTGTGGCAGTCGCAGCTGGCTGCCCCACAGCGATG
AGGATGCCGCCATCCGCGTACGTCGCTGCACGGGCGCAGAACTCGCGCAGTTGACGCAACAACTTGTCAACGTCTACCCGCTCGTACTGGGTGTGACTTT
GCCAGTGGAGCCGCGTGCCCACCACCGTCGTGCCCGTCATGCTGTTGCAGTGTCGAGTGCTGCTTGGCGAGTGTCATGGAAATGCGTCACATCGCGCGGT
ATCAGATTCAGAAACGGACATCGAGGTCCTGCTTGTATTGTATTTCACGGATGGTGGTTGAAAAGCTAAATGGGTAGACCCAACTTTCAGCTTCACGCCT
CCAGGTGATGCACACGTCCAGGTGCTACGCCAAAGTGAGCGATTTGAGCTGCTGCGCGTTGCAGTTTGCTCGCCATCTTCTTCTGATGCCACTCGAGCCG
TTTAGGGTCCTCCAGTCCGTCCACTTGCCACGCGATGCTGGGCACACGCACCAACTTCGCTGTTGTGGGCGACGTGCTGTTCGCGTAGAGCTGCTGGTAC
ATGGCGATGGTGGCGACCTCTTCAATGCCCGCAGCAGAGCCGATTCCATCGACCTCGAGACGCAATGCATCGCCCATCAGAGCGAAGCCGACCTTCGTCA
GCTGCTCCAGATTCCAGAGCGCGAGCGTGTTCCACGGAGATGTCAAGCCGCT