Description :
From Genome Similarity Track
Location :
Scaffold_265:7631- 9592
Sequence
1961 bases(100 bases per row)
TAACCAATATAATGAGATAAGACACCACACATAACCCAATAAATGAAGTAAATCGTGAGTAATAGTGTCCAGTATCAATCTCCACCAATCCAGCCTTTCC
ACGAATCACAAGTCCACTGGGTGTCCACGACACACCTTGACGGAAAGTAGCCTTCCAACACGTTACTGAAGGGTCAAATAAAAAGACCTCGCTGGCGGTA
TCATCCTCTCGATGTCGATAAGCTGCCAAATATGAGGGTTTGAGTATCACCCAACGTCCGAGTACACCAGTGCGGTGCTGAAAGAACATGTATATAAACA
AGATCAAGTACGTCATAGTTAGTATGAATGCAACACCCACGAAAAATCGCTTAACATCGAAAATCCTCTTGGAGTCGTCTTCGTTATTCCTCGCACCCAC
AAACTGCGGGAATTCCGCAATGACCACGAATAAAATTGGACATATGAAGAGAACGACACTTGATGCAAATAAGAGCCTCATCCACGTGTGATACAGATGA
CGATACCAGACTTCCATCCTGCGATTGAAAAACCTGTACAAGGGCAATTGGAACGCGCCATTGATTCGAACGTGGACATAGCCTTCCTTTAGTGAGGGTG
CGTATTGCTGGATACATCGATTGGGAGATAGCTCCAGGAAGGAGAGGAGGGGTTCCAGCGTCTTCACGTACTCTGTGTTGTCTAAAATACTATCCAGGTA
TCTCTGTACAAATTCTCTGTCTTTGATACGCTCTTCGGCGTGTTTTTCTCGCCATAACGCCCACGGGAGCCCTACTTTTGTAAACCTTTTGCGATAGGAA
TAAAGCGTATAGAGAATCAAATGTAAATGGAGTAACACGAGTTGTTTCTGATTGAATGTGATTTCCCAGTGATTTGCTCCCCACTTAACACGACCCACAA
ATAAACAGCAAGGAAGCAGTCCTGAGCGATCAATGATTGTGCGCGTTATTCGGCAGGATACGTTGCTACAAGACTCCAATGGAGTGTTTGATTGTATGGC
GTCATGTGGTGCGTCTGCATGGAGCGACATTGCATGTGCTTTATGGTGGGAGGTTTGAGTGCATTAATAGAAAAAAGGAGCTACTGGTACGAGTGCTAAT
TAACACGCAACGTGTAGAAATTTGAGACTTTTCTCGCAGTTTGAACCCAAAAGGATGCGTCGTCAGAGGTTTGTATTGGAGAATACACTGTACTTGTGCT
CCGTACCATCCCGTACGTATAGTAATAAATGGACAGAATTTATACCAAATGACATGGGGTCATTTCGATCCTGTCAGACTTCATCTGAGGTCTACAGGCG
TATCAGAAGATTCCAATTGAGTCGAAACCGGTATTCAGAATGAGCTTGTCAGACTACAGCATCTATAGAATCACTTCAGTTTGAAAGATATGAAGTACCC
TGGGATATGGTACACACGGCCAGAAAAATTAAGCTGAGCCAGTCAATCGGGATAGAACGCACTGTATGTATTCATAAGTCGTCGTTCCAAATAAAAATGA
GATAAGATCGAACCAATGGAGATTTCTACCGTCAATTACAACAGTGGGACACAATCCTCGTGCATCATTTCATTCTGCCTGCTTTTCTTACATCACTTCT
GAATTTGCTCTCTACTGAAATCAACTATGGTATCTGCGATCACTGCAGTGATCCGTAGCACCATCTTTTTCAGTGCTGCGAATTTACGTTTGATAGCGGG
CGGGTCGCTATATGACAAAATAACAGCAATCATGGCCCGGAAATCATCGCTTTTACAAATGAATCCTTTGAATTACCCTTCAAGTTTGGGGTTTGAAATA
AGAAGTCACTGTGAGTGGAACGAAACAAAGGGTCATGCTCTATCTGGCGATGATAAAGCCGATTTGAATCGTCTGGCCAGAAAAGTGATTACTGAGTATT
ACGCGCAATTTGAAAGAGATGCGCCCACTATTAACGAATTGTATTTCAGTCTGTCTCTTTA