Description :
From Genome Similarity Track
Location :
Scaffold_150:7630- 10083
Sequence
2453 bases(100 bases per row)
GGTGGTCCACGAGGTGGCGAGCTCAAACGTCCACCCCATCTCGGTAAAGGTGACGAACTGCGTCTCGGTGGACCCCACGACGAAACATCAGTGCGTCCAC
GAGGTGGCGATCTGCCACGCAATCTTGCATACCAGGTGGTGACCGACTGCGTCCTCGATTGAAGTACATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGCCTGTCTGCTCCGTGCATTCAGCGTACCAGTGACCGTCAACACTGCAGTTGGCGCACTGGGTACGCTGCTTCTTGTCGGCCACAGCCTTCATTCG
CTTGCGTTGCAGCTTGCCGCGCTTGCGATTGTTGCCGTTACTCCTACTTGCACCCTGCCCACCAGCGACATGGGTCACCTGAATAGAACGTGCCACAGCA
GTAGCCGGCTTCGACTGCAGCTCGAGCTGGCTGCGCTGGTGTTCGGCCGACCGGAGACGCTGCAATGCCTCTGTCAGCTTCAATGATTTGCGATCTTTGC
TGCTAATCCAGTTTGCGTATTCTCGAGCGAGGTCACGGAACACCAACACGAAGTTCGACAACAACAGGCTGGCGTGCTGCCATTCCTCAAACCCGCCCTT
GACCTGACGCAGCATCGTCACCTTGCGCTCGATGTCGTCGACGTACACTGTTACAGACTCGTTTGTCTGCAACATCCTCGTCATGAGATCGCGCATCAGG
TAATCGGGATTGACTCCGTCGCCGGCCTCGAAGAGCTTGGTGATGTAGGTCCACAGTAAGGACGCAGCCTCCATGTTGTCCCTCATCTCATCGATCTTGA
ATGTGGACCTCAAGTCCACTGACAGCGAAAGTGCGCGTGCAGAGAACGCCTTGTTCTTGCGTGCGCAGTACCATTCGTTGTACATGGGTTTTGGTATCCG
AGCGCAGCGTCAGAGCGCTCATCACCGTACGTTATGGCACCGAGTGTGCGTGTCTCAAAGTGTAGCGGCACTTCGCTGCGCCACGCCTTGTAGTCGGCCT
TGGTCACGAACTTGGGCAGCAGGATGTCCGGGGAGTTCCGCAGTGCCTTAATGTACTCCGCTAGTTCCTTGTCGTCGTATCTCCCGGGGAAGGTGTTGTC
CATGCCCGCTTCCTCACGCCAGTGCTCGCTTGCTCCACAGACGTCGCGCTGTTCCTCTGTCTAGGGCTGCCGTTGGTTTGGGACTTCCGCAGAATGAAAA
TCTTGAATACCTTCAAGCAACCTTCGGATGAATGCTTGACCATCCGTAATTTGGGCCAATGAGCGAATGAAACGCTCAACCTCGTTGTGCGACAGTGGTG
TGTCACTACCCACAGTCGCATTTCCAGCCAATCCTTGCGATCCTTGCCTTTGATTCGACGAAACTTCCGCTTGGTCTCTTGAATCGTTGTTGTTCACACC
AGCTGACACTTCAGCCGAGGCCTGCGCCCTGATTGGGCACATAACCTGAGGTGACGCAGGGCGCGTCACCGGGCTGCTTTCAAGCTGTCTATTGCTTCTT
AGAGTAGGTGCCATGAGGCAACTGACACTATAGTAGAGCAGGTAGAAGAAGTACGTTTAACACAGTAAATGCCGGGGAAAATCTCGACAGGACCGTGGCG
TTCTGGTGTGGGGCAGTTGCTTGCTGCAGATAGAAATTGCCGAAGTGTAACACTGCCACACACCCGAGCGTCAGCGTTCCGCAAAGTAGATTAGTTTATA
GTATCTTCAAGTAAGTCTATAGTAGACATCAATAAGATGCCGTTCACTGCGGC