Description :
From Genome Similarity Track
Location :
Scaffold_2521:763- 2769
Sequence
2006 bases(100 bases per row)
TCGGCCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCGCAAAGCTTCGGACAACTTGTTGCTGTTACGAGCAACCGTCTGGCGGCGTGCGAAAT
TCTTCGACGCCCCAGAGTCAATCAAGATTCTAAAGGGGTGATCGTACCCCCGTACACATCCGTGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTC
GAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCT
ACTGGTTCCCTGCGTTCCCATGTCCCCGGGATCCTGGATTCTGCCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGG
ACAGTCGCGCTTGAAATGGCCCATCTTCCCACAGCCGAAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGCTGGGGCTT
GTTCGACCGGGAGCCGACAAGGAGCTCCCAGGCCACGCTGAGGCCGGCGTACGCGCCTGGCGATGGCTGTACTCTTCTTGAAGAGCCACTTGAATCGCCT
CTTCAAGGGTGCTTGCCTGCACCCGGAATAGCTGAGTGCGTGCGGGGCCCACTCGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCATTGAGTGG
GTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCAGTTCGCGCCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCGG
TACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGCCCAGGATGTGAAACATCCAGGGGATGTTGCTTCCCGAGTGTACACCC
AACTCTTAGCACGACCGCTAAGGTTTAAGAGTGCAAAAGCAACACGCAGTTGCTCGGTCGAGATCAGAGCCGCGTCCATCTCGAGCTCTACTTCTCGGAC
CCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTTACCTTCAGCCGTATTGGCTTCGGGTGAGGCGGGTTTGCTCCCGCCGCCGGAGCCTGC
AGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCGAGCTGCTCAGCCGGTGCTGACACCACCGGGCTCTGCA
GGGGCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCAAACTGAGAGTCGTTCATATGGGAGAAGTCGTTCCTATCCATGGCAACGAGCTTCGG
AGAGGTTCAGGTAGTCTACCCGCGGTGGCGTGGATTGACTACGAGTGCTTCCAAGTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTACCTTC
CGAGAGTATACAAACTCTCAGTGAACGGCAGCTCACAGGTCCCCTCTTTATCAAAAGGGAGCGCAATGACCTACTTAAGGTACAATGTAAACTGAGTATA
TTTATAGGTAGATAAAGCTTAGGTTTAGTACAAACTATAAGTCACCTTTAGAAAAGCAATGTCATCTGCCAATGATGGGCTTCGGACGACCTTTGTACCT
TTGTAACCAATTATCCCCGCCGTAAGACGTGTCACACTTCATGTTAACTGAGAATACACTTAGGGCTTAGGTACCCCCTTTAACAGAATTAATTTAAGAT
GGGAGTTGTTTCCAGCTACATTAGAAAACAAAACATGTTTGGATTAGGGAGGGGGCCACTTAAGCGTCCAGGCTCGCCACACAGACATGGCGCTTTGGGA
CTAGATAGAGTAAGTTTAGTGATCGATTGGAGAGAATATATGGCAGCCCCTTCAGACACGGCAACGCAATATGTCACTACAAAAGGAGGGGGTGCCGCAA
CAGCCGGATGCGATTGGCAGTGGGCGAGTAAGTAGGCTTACCTTCCGTTGGGAACAGCACGCTTGATGTGGAGCTAAGAGCAAGCTCATCGAGGTCCTCT
GCGCAC