Description :
From Genome Similarity Track
Location :
Scaffold_68:76298- 77945
Sequence
1647 bases(100 bases per row)
TTTTCAAGACCCAAATGCCCTCCGACAGCGGTATCATGGGCCTCAAAGAGGATTCGATAGTTTAAATTCTTATCGTGAGGCACGACAATGCGAGCGGTAT
CCGTTACATCTGTGTGATAGCACAAGAGACCATTACCGATCGAATATCGATGTAGACTGTCCCGCAAGCGTGCCGATAATTGATTGTCCGATTCCTTGTA
TTCCTCACTCCCAAGGGCATAAAACAATGCCACACACTGAGAATCCCGTGGATATGCCACACGAATTAACTCCTCTATAGGAAATGACAAAGTCGTGACA
TGAGCAAGCTCATAATCAGGTCTGCGAGGGAGGGCATCTGCTAACACATTTTGTTTGCCTGGCTTATACTTCACTTCGAACATATATTCCGGAAAGAAGG
AAAGCCACCGAGATATTCTCTGAGAGACGTGAGGCGACTGTGTCGCCGTGCGTAATGACGCATGATCCGTGTAGACGACGAATGGCTTGGAGCCGAGCAG
ATGAACGCTAAATTTTACGAGCCCATACTCCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTTTCAGCAGCTTTCAGCTGACGAGATTCAATA
CGCAATAACTCGCTCGATGACCGCAGCATCTGTTTGTAACAGAGCGCTGTCGATGGAAAAGTCGGATGCATCGCAGACAACGCTACAAGAGTACTCAGGA
TTTGGCAACGCCAAAATGGGATCATAGAGGAGACTCTCCGTTATTGCTCGAAATTTGTTAGCATGGGTGTTGTCCAGCCGCAAATCTGTGTCCTTCTTAA
GGAGATCTGTTAATGGCCGAGCCATATTTACTTAGTTTCCACTGTATTTGTGTAAGTAATTGGCAAGGCCAAGCCGCTTACGAAAGTCCTTTTGATTCTT
AGGAATCGGCCAGTCCACTATAGCCTTGACCTTAGCGGGATCCGCTCTAAGGCCGCGCTTACCAATGAAACATCCTAGAAAAGAAATCTCCTCTGCACCA
AAAATGCATTTAGACGCGTTGGCGTACAATTTATTAGTGCGTATGCACTCAAGCACGGCTCGCAAACGACCGATGTGATTTTCAACATCTTACCGACCTT
GTTCGGCACGACTATGTACAAAAATGTCATCAAAGTACGTCTTTGCGTAATCCCGATGTGGGCGGAAAAGTTGCGTCACCAGACGATTAAATGTTGTCGG
CGCATTAGACAGCCCTTGGGGAATCACCAGCCATTCCCATAGCATACCACTCGGAGTGCTCACTGCTGTGAGCGGAATATCACTCGCTCGCATGAGCAAT
TGATAATATTCATCGACCAAGTCGAGTGCGCCATACATAGTACAACCAACCATGTTGTTTTGAAAAACATCCTTTCGAGGAATGGGTGTCTGTGCCGGAA
TAGTAGCCGCATTAAGCTAGTAATAAGCATGCTCAATACGCCACTTGCCGTTCGGCTTTTTGACACAAAATGTCGGTGTCGAATGTGGAGATTTAATCTC
ACGTACCATTCCTTCCTCGTGCTTTGAAAAGGAAGAAGTCATCAATGACATCACATTGCTCCTTAGGCAAGGGCCACTGTCGTGTGACACAATATTTAGT
CCCAGGAACTAAGTCAATTTCATGACGGACACCTCTATCTGGAGGCA