Description :
From Genome Similarity Track
Location :
Scaffold_22:762757- 766769
Sequence
4012 bases(100 bases per row)
TATCCTCCGTTGCTTCATTTCCCTCGGTTGTTAACACTCGAGCAACCGAGATGTATGTTCCGTCCAACGCCGCTACGGATTCTTCCCTTGACTCAACATT
GGCATCCGCTTTGATTTCAACAGTCGGTACTTGGTCCATCTCCTTCCCATCCTGGTTTCCCATTTCTGGGCCATCTGCCGAGTCGTCGTTCGCAATATTG
AATGCGTGGGCCGCCGACATATTGGGTTGTTGACTTTTGTTCCGCTCCTCGTTCTGCCGCTGTCTTGGCATTTCGGAATTCGCACCAATCTTGCAATGAA
TACTCGGTGCCGTACTCAACACCTTCTGCGCGATGCCTGTATCCTCTGGATCAACCACCGATGGCTCGTTCGCAGATTTGGTGACACACAAGGCCGGGAC
AGCTTCGTCAAAACGGGTGACTCCATTCAATCCAGTGCCGTTGCTTCTCGCTTCCGTGGTCACCCCTGACTGGACTCTAACACTCGTTGGCGTATGTACC
ACGTTTACCGGCCTCAGTAGTTCGTGTGTACGCACTACCGAGGCTTCGTTCGCGTTATTGCCTCCGCCATTGTACGTGTCCAAAGATTCTGCGGAAGGCT
GACCGTCGGCCGAATCCCCGGCTGTCACCCTAGACGCCAGACAGGCTTCCACTCGTTCACGTTCTTCCAGGATCAGTGCCCAGCGCTCTGCACATGTCAG
ACGATCACTAGAATCCACTAGCGAGTCTTCTAGAGGTCGTGCTAGCACCCCACCGGGTTCTGGGTAGTATGGTCGATCAACTGCTGAAGGCTGAGCTGCA
AGCCATTGTTCGTAGATTTTGCATTCACGCTGAAAGAGCTCGCGGTCTCTACAACCTTCGTAGGCTAACACTTGCCAGTCTTGGTACTTCTTGAACTCCA
GACGCACATAGCCGTCACCTCGTGGCAAATCCCCATCTGGAATCCACATCGCGATCGAGTCGTGTGCTGGTAGGTACACAGTTCGATCAGACACGTTGGT
CAATCGAATGTTCTGAGGCCGTCCACGTCGAAACCTCGTCACTGACGGGATTAGCTTGTTCGTTCGACGAACCCACAGTACGTGTTCTTCCAGCCCGACT
TGACGCTTCGCTAGTCGATATTCTCGCCACTCGTGCGCTTGAATGTCCAACCGCTCGGGTGGCCCGGCGTTAACATGGGAGCCGTATTCTTCGCTGTCGA
TCATGTTCTTGGTCTTTATCAGCGGGATTTGGACTTCGTGCGGTAATTGCGCCGCACCGTGAAACAGGTCCAACCGGATCCCATCTGGGATCATAAAGTC
GGTCCCGAGTACCACGTCGACGCCTGCACTATGCGCCATTACCCACATCTCAAACTCGTACACCATCTCCCATCCGAGCGTAATCTTGACGCACGCTCGC
CGCGTCGTAGACACCTTGCCTTCGTTAATACCTTGAATGTCAATGCGGCGTCCGTGATCGGGTACATCTCGGAGTCGCAACTTCTTAGCAAAGGCGTCAG
TGATCACACTAACGTTCGCTCCTGTGTCGAGGAGAATCCTCGTTCGCTGGTCGTTCACAGCGCCTTGCACCAGAGCTCTCATGCTGATCCGTCGGTCGAA
TTTCTTGGCCGACCACCACCCCTGTCTCTCGCCAGGGTTCAACTTCATCATCTTGGAGTGACCCTTGGGCTCGTCTCGCGCTGCACTCGAAACCAAGCCG
AGCGAACCCTCGCTGGTGCCCTCATCAGCATCAGCACACTCCACTATTTCTCCAACACCTCCACCGAGGATTCTACTCCTCTCCTTTTCATTTTCCGTCG
CGTTCACACTTGTTACGTATTTATCAGGCCATTCACTCTGCCCCATGAAAGCAAAGATACACTCTGCTTCCATTGAAGGCTCGGTTAACTGTGGCAGCCC
GATAGGAGACCAACCCAGTTGTAGTTGGCGGGCTGCCTAGTTTAAATGACGTTCTTGAAACGGACGGCCCTTGAGCTCTGGCGGGAGTTCCTCCTTCGTG
CCCTTAGTGCGCACGAATTTGGCAAGGTCTTGGAAGTTGCGATAAAGTTCGCATTGTCCAGCATCGTGGAGTTGTTTGCAGAACTTGCATCGCTTGTTAC
AGTAGTGGGCGGAGTGACTCATGCCACCGCATACCGCGCATGGTCCGTACTGTGGGCGTCGGTTTTCTCGGTTGAAGTCACGTCGACCGCGTTGGTCCTG
ATTGAACCCACGGTCACCACCTCGGCGATCTTGATTGAAGCCATTCTCGCGATCAGGCGTGTTTCCACGCGGCTGACGGTTGTCTGAACGTGCGTAGGTG
CCTTCAGCAGCTGCACGGCGTTCATTTTCGTTAGCAGCGGCGAGGTATCGGTCGTTTTCATCCAATGCGAAATCACCATCCGTATTATCGGGCTGAAAGT
CGTTGTACTCGTCTTGGACATCGGTGTAAGCGTTCGGATCTTCGTTTGAATACTCGGTGCCTCCCTGAGCAGCTTCACGACCTTCTAATTCAGCTAGTAG
GTCATCCACCGTGGCTTCAATGAGCGTCACTCTTGGTTTGTTTCGGTTGTCATCGCGGCGGCGGTCATCACGCCGGTTGTTGCGGGCGAATCCATCGTCG
CGTCGCGTATCACGACTCTTGGAGTATCGGTACTCACTGTCACGCTTGGCCATCCTCTCCTTGCCCTTGAGAACATCTTCGATGATCTCTTCGAGCTCGT
GAATGTCGGCGACTCGAGCGTGGTAGAGACTCTCCGCCAGCTTGTCATCATCGCATGTTGCCAGGAACTGCTGTACGTGTTCTTTCGCGTCGCGACCACT
CTTCTCGAAGTGTAGACGGGCGGTCCGAGCATAGCCATTCAGCCTGTTTATGTAGTCGCACAGATGTTCATTACGTTCCCGCTTGGCGGAGTAGTAACGC
GACAGTGCCGTCTGCGTGAACTGCGAGCAGTAGTAGCGGATGAACGCGTCGCTCAGCAACTTCCACTTGCGCTTCGTCTTCTTCGGAAGTTGACGGAACC
AATGAATGGCTCCGTCCCGGAGACTTAGCTCAAATGGAATGCACCATTTATCGGCATCTGTGTGGGTTCCAGTCATTTCATAGACGAACCCACGGAGCCA
CTGCATACAGTTCTCGCTCTTGTTGCGAGAGCCTGAGAACGGCGTGATGCGATCCAGCGGTCGGTGCGAGGCCATTTCGATCCTCGGTGTTGGGTCCACG
TCGTTCAGCGTCGCTAGCTCATTTATCTGACGCATCAACTTGAGTTGAGGATCTTCCTCGTCGAATGTACGCACCAAAATATCATCGTCACTGGACAAAC
CATCGCTGTCGACTTGACGACGTCCGGCACCACCTTTGGGAGCTCGCGCACCGCCTCGGCGACCGAACGAACCCTCGTTACTTGCGTAAATACTTTGCAT
ACGGCTCCTCGAACGTGGCGTAACCATGTGCGAGTCTTGAAAGTACGGTGAAGCTTCGGTAGTGCCAAAGGCACCACGCTCAGCTCCACGCTTGGTCGGA
GGAGTACGAACGAGTCGTTGGGGCGTCAGCGGCAATGGAATCTTGGACGGATCTTCATCTTGAATCATCGGTCGACTCACAGGTTGCTTTCCGGCATTGA
TGCCAACAGCGCCAAACGCCTTCCGAAGCTTCTTCTTCCATTTCTGGAGAGCAGCTCCGGCTTCATCTTAAACATCTATTGCAGCAACCTGTCTGTCCGT
CACACTAAATTGTCGTGCCTGTCACGCTTTTCCGGACAAATCATTGGATAAAATAATTTAAATATTTCTACTGGCTGCCGAGCGCAGCGAAGGTGGCTTT
AATTGGTTAAAACAAGATTGTGCTGTCGACATCAATAAATGGATATGTTTCTTTTTTTACATATGGGGATTTGTACAAGGCAAATACATTATCCGAAGGC
GGTATCGTTTTAGTATTATTTACTTTTTCGTAATGCATTGATATTTGAGTACTAAACGGAGGGCAGGGTGCTTAGCGTACACGTAAGCATGCGTGTTTCC
GAGGACATGGTT